with a little help from my friends chords in c
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
... Heparin Heparan High affinity heparin Heparin pentasaccharide – Dermatan sulfate Heparin Heparin Heparin – Heparin Heparin ⁄ calcium 4 2 4 1 3 Factor Xa HCII Thrombin PCI Thrombin fXa aPC · · · · ... Calcium enhances heparin catalysis of the antithrombin-Factor Xa reaction by a template mechanism: Evidence that calcium alleviates Gla domain antagonism of heparin binding to Factor Xa J Biol Chem ... reported in a range of publications cited in this article) Serpin Enzyme Glycosaminoglycan kass (M)1Æs)1) Antithrombin Thrombin – Heparin Heparan High affinity heparin Heparin pentasaccharide – Heparin...
- 10
- 668
- 0
With a Little Help pptx
... sewn from a salvaged WWII bivouac tent; a small card advertising the availability of artisanal truffles hand-made by an autistically gifted chocolatier in Islington; a brick of Pu'er tea that had ... monastic order, a thousand calming, clarifying mandalas and saints devoted to helping him think clearly From the nearby cubicles, Lawrence heard the ritualized muttering of a thousand brothers and ... was finally able to master his mind, 38 to find relaxation and calm at the bottom of the thrashing, churning vat of despair When Randy came in, Lawrence heard each bolt click and the hiss of air...
- 282
- 494
- 0
báo cáo hóa học:" Research Article ´ ¨ Sharp Constants of Brezis-Gallouet-Wainger Type Inequalities with a Double Logarithmic Term on Bounded Domains in Besov and Triebel-Lizorkin Spaces" pdf
... regularity to the gradient flow of the harmonic map into a sphere We also mention that 1.1 was obtained in the Besov-Morrey spaces in In what follows, we concentrate on the case q n and replace ... Mathematica, e e vol 196, no 1, pp 91–101, 2010 K Morii, T Sato, and Y Sawano, “Certain identities on derivatives of radial homogeneous and logarithmic functions,” Communications in Mathematical Analysis, ... Morii, T Sato, and H Wadade, “Br´ zis-Gallou¨ t-Wainger type inequality with a double logarithmic e e term in the Holder space: its sharp constants and extremal functions,” Nonlinear Analysis,...
- 38
- 308
- 0
Báo cáo lâm nghiệp:" Comparison of soil water-contents as measured with a neutron probe and time domain reflectometry in a " ppsx
... Bedrock: Paleozoic, schists, grauwackes Rock outcrops: Occasional Soil typology: Haplic and Cambic Umbrisols Vegetation: Quercus pyrenaica, Pteridium aquilinum, Cytisus scoparius, Erica australis ... for financial support The invaluable technical assistance Jesús Hernández and Miguel Tapia is acknowledged REFERENCES [1] Cermak J., Prax A. , Water balance of a southern Moravian floodplain forest ... content, heat capacity and thermal conductivity with a single TDR probe, Soil Sci 161 (1996) 22–28 [19] Rabadà D., Gallart F., Monitoring soil-water content variability in the Cal Parisa basin (Alt...
- 9
- 353
- 0
báo cáo khoa học: "Effects of plasma concentrations of 5-fluorouracil on long-term survival after treatment with a definitive 5-fluorouracil/cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma" doc
... T, Nakamura T, Makimoto H, Hamana N, Uchiyama H, Shirasaka D, Morita Y, Yamada H, Aoyama N, Sakaeda T, Okumura K, Kasuga M: Circadian variability of pharmacokinetics of 5-fluorouracil and CLOCK ... predictive of clinical efficacy after treatment with a definitive 5fluorouracil/cisplatin-based chemoradiotherapy in Japanese patients Page of with esophageal squamous cell carcinoma J Exp Clin Cancer ... Demographic/clinicopathologic characteristics and clinical outcome after treatment with a definitive 5fluorouracil/cisplatin-based chemoradiotherapy in 49 Japanese patients with esophageal squamous...
- 7
- 259
- 0
Báo cáo y học: " Adenovirus serotype 7 associated with a severe lower respiratory tract disease outbreak in infants in Shaanxi Province, China" pps
... TGGAAATGACCTCAGAAC 20089-20106 515 6L 7U GAACCAGGAACCAGTCTT GTGGATGGGGAAGGATAC 20586-20603 20543-20560 506 7L TAAAGCAGGGTGGGCTCA 21031-21048 8U CATACCGTTCTCCAGCAACT 20914-20933 8L ATCAAAAAGGTAGCAGGT ... AGCCTCAAGTTGGAGAAGA 18909-18927 522 3L GCAAAAGCTGATATGACAG 19412-19430 4U CATTGGCTTCAGGGATAAC 19288-19306 4L TGGCGTGTACTTGTAAAC 19748-19765 5U GGCAACAATCTGGCTATG 19661-19678 5L GAGGTTGATGCTGGTGAA ... Sequence (5’-3’) position amplicon length(bp) 499 1U GAACAGCATCGTGGGTCT 18186-18203 1L GGACCTCTATCAAGCAC 18668-18684 2U CGGGAGGACAATACATAC 18569-18586 512 2L 3U CCTTCGGTTGGTGTTACT 19063-19080 AGCCTCAAGTTGGAGAAGA...
- 7
- 271
- 0
Báo cáo y học: "The association between weight loss and engagement with a web-based food and exercise diary in a commercial weight loss programme: a retrospective analysis" pdf
... use a daily food diary which links to a database of over 40000 branded and unbranded food items, automatically calculating an estimate of calorie intake A daily exercise diary encourages additional ... planned the analysis strategy, analyzed the data and drafted the article in collaboration at all stages with JW Both authors read and approved the final manuscript Competing interests Jane Wardle ... each model the dependent variable was percentage weight loss, and initial BMI, and duration of programme use were included as covariates Age was not included as a covariate as it was not associated...
- 7
- 284
- 0
How to Help With Math Homework - When the Answers Aren’t in the Book (A Guide for Students, Families, & Friends) pot
... with centimeter and inch scales Protractor Calculator: Minimally, every student should have a scientific calculator with trigonometric functions (sin, cos and tan) for use at home Graphing calculators ... William Blatner Photos by William Blatner and Jackie Rigali How to Help With Math Homework When The Answers Aren’t in the Book Many math curricula, such as the Interactive Math Program (IMP) and Connected ... you can find more than one way, all the better Students interact as a group to help each other understand the mathematical concepts Show your work! A record of your work shows effort, and helps...
- 12
- 480
- 0
Tài liệu Gynecological cancer patients’ differentiated use of help from a nurse navigator: a qualitative study ppt
... with a range of characteristics including age (median age 63 (range 36–79)), marital status, place of residence and gynecological diagnosis (Table 1) All characteristics in Table emerged in the ... Vargas RB, Ryan GW, Jackson CA, Rodriguez R, Freeman HP: Characteristics of the original patient navigation programs to reduce disparities in the diagnosis and treatment of breast cancer Cancer ... patient navigator program implementation for equal access to cancer care and clinical trials: essential steps and initial challenges Cancer 2006, 107:2669–2677 Ricoeur Paul: Time and narrative London:...
- 11
- 695
- 0
Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc
... in the crystal (data not shown) Spectroscopical and photochemical properties of HPBC The perchlorate and nitrate salt of HPBC had identical optical absorbance spectra with maxima at 212, 304, ... evaluated without application of spectral deconvolution analysis Using the oxygenation of myoglobin as a different indicator, significant flash-induced absorbance changes were recordable even after ... Recording of FT-IR spectra Static IR spectra were recorded with a Bruker 66V/S spectrometer, evacuated to 8–10 mbar residual pressure The sample containment, maintained at C, was purged with dry air...
- 8
- 474
- 0
Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt
... (5¢-GACGCCGCCGCCCGCG AAGCCGAAACCCGT-3¢) (for H266G substitution); and RDmutY1 (5¢-GTGTAGGGATCGGGCCACG-3¢) (for D370Y substitution) To replace Asp370 in Hyb-24 with other amino acids, the mutant ... out by PCR [21], using the following primers (mutated sites are underlines): RHmutN1 (5¢-GCCGCCGTTCGCGAAGCC GAA-3¢) (for H266N substitution); RHmutD1 (5¢-GACGC CGCCGTCCGCGAAGCCGAAACCCGT-3¢) (for ... primer with NNN at position 370 (RDmutX1) (5¢-CCGGTGCCAGTGCTCGGT NNNGGGATCGGGCCACGACGACAGC-3¢) was used After nucleotide sequencing of the mutants we confirmed that isolated mutants possess a single...
- 10
- 625
- 0
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc
... GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAGGGAT TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA ... ensures accumulation at polyanionic microbial cell surfaces that contain acidic polymers, such as lipopolysaccharide and cell-wall-associated teichoic acids in Gram-negative and Gram-positive bacteria, ... methionine codon is shown in bold, the stop codon is in bold and italics Primer name Sequence Forward 2f 3f 4f 1r 2r 3r Reverse ACTGGGTACCATGGCTCAGCGTTGCGGTGAC CAGGCTCGTGGTGCTAAATGCCCGAACTGCCTGTGCTGTG...
- 10
- 505
- 0
Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx
... which possess a common cyclohexenone ring system linked by an amino acid or an amino-alcohol [11] In contrast, MAAs are UV absorbing metabolites of algae that contain an aminocyclohexenimine ring ... mycosporine-like amino acid derivatives in exposed, rock-inhabiting cyanobacterial lichens Oecologia 112, 165–172 Garcia-Pichel, F & Castenholz, R.W (1993) Occurrence of UVabsorbing, mycosporine-like compounds ... having a great potential to protect from UV-B radiation Collemin A is a new mycosporine, which Fig Comparative UV spectra of the fungus (mycobiont) and lichen Collema cristatum The mycobiont has a...
- 5
- 450
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... structural changes being minimal the trapping of two main-chain conformations and increased B-factors at 295 K suggests that the presence of the coordinating Lys in some way can in uence the dynamics ... manner as for M100 coordination and that unlike at alkaline pH, unfolding using GdmHCl induces a ligand-exchange mechanism Discussion Bacterial cytochromes c2 show a greater diversity in amino acid ... backbone atoms of 0.4 A Significant deviations for main- and side-chain atoms in the ligand loop containing the K100 are however, observed To accommodate K100 as a ligand a number of main-chain...
- 15
- 509
- 0
Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx
... 5¢-ATIACITGGGA (C/ T)ACITA (C/ T)TA (C/ T) (A/ C) G-3¢; band D Fig 1A, 5¢-TT (C/ T)GA (C/ T)CA (A/ G)ATITA (C/ T)CA (C/ T )C- 3¢; and a generic vector primer (T7 primer), 5¢-GTAATACGACTCACTATAGGGCG-3¢ PCR products were cloned ... (N-terminal) and SalI (C- terminal) restriction sites: Forward, 5¢-CGCGCTGCA GGTCATGAGAAATATGAAGGA-3¢; Reverse, 5¢-GC GCGTCGACTGAATAGTTTTGCAAGACGTACTG-3¢ They were designed to allow the amplified sequences ... (http://www.bdbiosciences.com/clontech/) and the genespeci c primer: 5¢-CCTCGTCAATGGAGTACTCGTAG CCATCAG-3¢ The amplified product was cloned in pCR2.1 as described for DNA sequencing DNA sequences were determined by standard...
- 12
- 458
- 0
Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc
... concentrations at which other toxins from the same scorpion, such as Cn2 (a mammalian-speci c toxin), Cn5 (a crustacean-speci c toxin) and Cn10 (an insectspeci c toxin) are very effective (doses ... divergent insect-speci c excitatory toxin) was used as the root The tree accurately differentiates between a and b Na-ScTxs, and the corresponding branches are labelled accordingly Amino acids shown ... bridge constraints were added to the calculations The dynamic annealing structure calculations were performed with the CNS software suite [44] Analysis of Na+-channel sequences By searching data banks...
- 13
- 434
- 0
Báo cáo khoa học: Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain pot
... for caerin 1.1, 5¢-CTAAGTGCTCAGCAATGACG-3¢ for caerin 1.11, 5¢-AGCATAACTGGAACGTGGG-3¢ for caerin 1.12, 5¢-CAGCAATAAGTGGAACAACG-3¢ for caerin 1.13, 5¢-GTGTTTAGCAACGGATTTACC-3¢ for caerin 1.14 and ... speci c of 5¢-adaptator and an antisense speci c primer as follows: 5¢-GGATGCTCAACTCTT TATTGACC-3¢ for caerin 1.1, 5¢-ATGACTTTATCCT AAGGC-3¢ for caerin 1.11, 5¢-CTGAGTGAACAGCTA TAACTG-3¢ for caerin ... caerin 1.12, 5¢-GACTTTATCCTAA GTGTTCAGC-3¢ for caerin 1.13, 5¢-TGTGGAAGGTG TTTACTAATGG-3¢ for caerin 1.14, and 5¢-GAAGT ACGTGCTTAGCAACGG-3¢ for caerin 1.15, and for nested PCR: 5¢-ATAACTGGAACAACGTGTGG-3¢...
- 14
- 305
- 0
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx
... Slovenia Porcine trypsin in Hanks balanced salt solution, Bacillus sp and Serratia marcescens proteases, Saccharomyces cerevisiae proteinase A, and Clostridium perfringens neuraminidase were all supplied ... erythrocytes were added and the remaining hemolytic activity was measured (t0.5 is as in Fig 1) Asterisks indicate a concentration above which the lipids alone became lytic Ostreolysin was incubated ... ostreolysin was assayed using HT 1080 (human brosarcoma cells) and MCF (human breast adenocarcinoma cells) After thawing, cells were grown for a week in Eagles minimum essential medium, supplemented with...
- 12
- 492
- 0
Báo cáo khoa học: Identification of critical residues of subunit H in its interaction with subunit E of the A-ATP synthase from Methanocaldococcus jannaschii potx
... CCATGGAACAGCCAGAGTATAAAG-3¢ (forward), 5¢AGGGAGCTCTCAGAATAACTTCTCTGTA-3¢ (reverse), respectively, were designed (restriction sites are underlined) Genomic DNA from M jannaschii ATCCÒ 43067DÔ was ... molar ellipticity values at 222 and 208 nm was calculated to be 0.95, indicating that a- helical regions within E1–100 are closely packed and are involved in a- helical interactions E101–206 comprises ... to amplify the two truncated constructs of subunit E (E1–100 and E101–206), the primers 5¢-GTTGCCA TGGCTGTGAAATTGATGGGA-3¢ (forward), 5¢-CTCCG AGCTCTCATGGCAGTTTAAC-3¢ (reverse) and 5¢-ATA CCATGGAACAGCCAGAGTATAAAG-3¢...
- 10
- 351
- 0
Báo cáo khoa học: Functional interaction of Escherichia coli heat-labile enterotoxin with blood group A-active glycoconjugates from differentiated HT29 cells docx
... OC-AR, PICT 05–10607) ´ and Secretarı´ a de Ciencia y Tecnica de la Universidad ´ Nacional de Cordoba (SeCyT-UNC), Argentina EMG was a fellow from CONICET and GAR and CGM are senior career investigators ... experiments content, measured after incubation with increasing concentrations of toxin Figure shows that differentiated HT29-ATCC cells increased the cyclic AMP content compared with control cells, reaching ... grants from Consejo Interaction of LT-I with differentiated HT29 cells ´ Nacional de Investigaciones Cientı´ ficas y Tecnicas ´ (CONICET), Agencia Nacional de Promocion Cientı´ fi´ ca y Tecnologica...
- 10
- 238
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008