whether these factors actually increase the risk of a brain tumor is not known for sure
Factors infl uencing the risk of breast cancer – established and emerging ppt
... European HFA Database, June 2007 BREAST CANCER Factors influencing the risk of breast cancer – established and emerging Established Risk Factors The established risk factors for breast cancer may increase ... explain about half of breast cancer cases and for the remainder, scientists and doctors are still unsure of the causes2,3 One of the suggested additional risk factors for breast cancer is the environment, ... further research is warranted to confirm the risk, all the ‘established or known risk factors outlined above are those that scientists and doctors agree can make a difference to a woman’s risk...
- 19
- 516
- 0
Báo cáo y học: " Hypothermia does not increase the risk of infection: a case control study" ppt
... twice daily in the distal part of the gut Surveillance cultures of endotracheal aspirates and oropharyngeal and rectal swabs were obtained at Day after admission and twice weekly thereafter Based ... 0.523) The rate of isolation of gram-negative bacteria from rectal and oropharyngeal swabs was low during ICU stay in both the hypothermia and normothermia patients (Figures and 2) Detailed information ... infection risk was comparable between the hypothermia and normothermia group, the colonization rate was significantly higher in the hypothermia compared to the normothermia patients This is the first...
- 8
- 309
- 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot
... end of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes on the C acidovorans plasmid was established using the AlkPhos Fig Location of the xdhAB gene operon on an isolated Comamonas ... contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated average molecular mass of the heterotetrameric (a2 b2) protein is 290 298 Da Electrospray MS of ... recombinant Comamonas acidovorans xanthine dehydrogenase (XDH)AB (low aeration) and XDHABC preparations All spectra were calculated as an average of four or five scans to reduce the signal-to-noise ratio...
- 11
- 584
- 0
báo cáo hóa học:" India-US collaboration to prevent adolescent HIV infection: the feasibility of a family-based HIV-prevention intervention for rural Indian youth" pot
... for all participants [35,40] As the pada lacked a common space, the girls and the mothers groups met in the house of the pada worker, and the boys and fathers groups met in the house of the angan- ... later he passed away Finally, another father shared his familiarity with HIV/ AIDS via his work as a truck driver, "I am a driver and these things [AIDS] happen earlier to us." Unlike their adolescent ... background The study was conducted in Aghai, a village in the Thane district of Maharashtra Thane, which is north-east of Mumbai and adjacent to Pune, has a population of 8.1 million, of which 30% is...
- 13
- 504
- 0
Báo cáo hóa học: " Research Article Impact of LQI-Based Routing Metrics on the Performance of a One-to-One Routing Protocol for IEEE 802.15.4 Multihop Networks" docx
... enable the calculation of the cost of a path, based on the LQI values of all links Therefore, we chose to evaluate the performance of these LQI-based routing metrics for NST-AODV Note that the ... Standard deviation of the LQI against the average LQI values the LQI measured in each link The LQI is almost constant for high average LQI values For instance, the standard deviation is below for ... successful frame delivery in a link The path cost is the sum of the link costs of the path The metric takes into consideration the quality of all the links of a path Note that LETX has the same aim as...
- 20
- 397
- 0
The first use of cheese as food is not known
... mechanisms: the raw milk is pasteurised to destroy most enzymes and contaminating bacteria; fermentation by lactic acid bacteria increases the acidity which inhibits growth of food poisoning and ... Rennet and Form Curd The rennet is the enzyme that acts on the milk proteins to form the curd After the rennet is added, the curd is not disturbed for approximately 30 minutes so a firm coagulum forms ... Some varieties of milk are made from raw milk so they are not pasteurized or heat-treated Raw milk cheeses must be aged for at least 60 days to reduce the possibility of exposure to disease causing...
- 12
- 176
- 0
Piloting Local Decision Making in the Development of a REDD+ Compliant Benefit Distribution System for Viet Nam
... a village-specific scenario that involves a realistic land boundary area that is familiar to participants An assessment of the existing infrastructure, agricultural activities and other variables ... just the monitoring of forest carbon Instead, PFM recognises the role of local actors in generating data for a range of REDD+ and broader collaborative sustainable forest management In particular, ... participants instead of cash payments, such as T-shirts, notebooks and caps The team had the impression that the lack of financial compensation discouraged participation, with many people leaving...
- 91
- 142
- 0
báo cáo hóa học: " The effects of a graduated aerobic exercise programme on cardiovascular disease risk factors in the NHS workplace: a randomised controlled trial" pdf
... cardiovascular disease risk factors and disease, than actual physical activity level [25,26] As a consequence it has been shown that it is only those individuals who increase their VO2 max, rather ... VO2 max, rather than their actual physical activity level that reduce their relative risk of cardiovascular disease risk factors [27] This has been attributed to a reduction in large artery stiffness, ... 38(2):149-157 Lakka TA, Venalainen JM, Rauramaa R, Salonen R, Tuomilehto J, Salonen JT: Relation of leisure-time physical activity and cardiorespiratory fitness to the risk of acute myocardial infarction...
- 10
- 662
- 0
Báo cáo y học: "Risk factors associated with the loss of cartilage volume on weight-bearing areas in knee osteoarthritis patients assessed by quantitative magnetic resonance imaging: a longitudinal study" pot
... analysis J-PR contributed to study design, acquisition of data, analysis and interpretation of data, and statistical analysis M-JB and FA contributed to acquisition of data and to analysis and ... condyle at the anterior and posterior areas and for the lateral tibial plateau at the anterior area further explore the risk factors that are selectively associated with more rapid disease progression, ... new and unique information about the topographical loss of cartilage in the different subregions of the knee and the associated risk factors Moreover, the impact of the location and rate of cartilage...
- 11
- 518
- 0
Báo cáo y học: " Sociodemographic and occupational risk factors associated with the development of different burnout types: the cross-sectional University of Zaragoza study" docx
... time of the characteristics of an organisation The recognition of these variables will assist the process of clinical differentiation of those affected by the syndrome, as these are factors that ... recognition and understanding of these clinical profiles This goal does not require that the established associations must be of a causal nature Nevertheless, the fact that these sociodemographic and ... gender and occupation variables kept their statistical significance in the multivariate analysis for this profile Specifically, the ASP group had a greater likelihood of having a high score than...
- 13
- 448
- 0
Báo cáo khoa học: "A farm-level study of risk factors associated with the colonization of broiler flocks with Campylobacter spp. in Iceland, 2001 – 2004" pot
... that practice was deemed to be the standard for the farm Variables Table lists the categorical variables that were available for analysis Only farms with complete data for all variables (28 farms) ... presence of data in the table is an indication that the variable was associated with Campylobacter colonization in the respective model, whereas the absence of data indicates that the variable was not ... models Discussion An increased risk of Campylobacter was associated with increasing median flock size on the farms For example, as the average flock size increased by 5,000 birds, the risk of Campylobacter...
- 12
- 343
- 0
Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"
... emphasize what Streat and coworkers [15] termed, the large risk of unacceptable badness’, rather than a vanishingly small potential for benefit 318 There are far worse things than death, and many ... Medically inappropriate care causes pain, suffering, and discomfort The fundamental maxim for these patients should be comfort Extraordinary life support for patients predicted to die does not ... exists to manipulate it Life support generates an outcome that is no longer inevitably fatal Physicians not have an exceptional track record in explaining end -of- life issues to patients and their...
- 2
- 463
- 0
Báo cáo y học: "Grb2-associated binder 1 polymorphism was associated with the risk of Helicobactor pylori infection and gastric atrophy"
... A/ A was associated with the low risk of H pylori infection while the G /A and A/ A genotypes together may increase the risk for gastric atrophy The biological mechanism of this polymorphism remains ... confronting two-pair primers) [19] The primers were F1: 5’ GGT TTA AAC TTT ATT CTG ACT GTT CCC, R1: 5’ ACA CAA TTT AGT AAT AGC CAA AGT CAA C, F2: 5’ GTT GTT GTG AAG TAG AAA CTG ATT TCT AA, and R2: 5’ ... Gab1 G /A+ A /A G/G G /A+ A /A G /A+ A /A G/G G/G G/G G /A+ A /A Total 296 (65.2) 158 (34.8) Gab1 polymophism and H pylori infection risk The Gab1 genotype distribution of the control group was in the Hardy-Weinberg...
- 6
- 541
- 0
Báo cáo y học: "The association of meat intake and the risk of type 2 diabetes may be modified by body weight"
... or cardiovascular disease between the baseline and follow-up FFQs, only dietary data from the baseline FFQ were included in this analysis For other participants the average of the baseline and ... California [4] In that study there was no information on associations of different types of meat and the risk of diabetes Poultry consumption was associated with a moderate decrease in risk of ... intake We repeated the analysis after exclusion of participants already diagnosed with chronic diseases (CHD, stroke, and cancer) and found similar results (Table 2) The risk of type DM for participants...
- 8
- 701
- 0
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model
... to MFIs, and impact of Government support to MFIs amongst lower income populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors ... by the MFIs to obtain loan as sustainability of the job is not secured High inflation rate in Pakistan also deepens the misery of the labor class, which has no other alternative to increase their ... economic, political and communal facets These facets have a sound influence on behavioral and attitudinal aspects of individuals An in-depth analysis in each of the broad parameters revealed the following:...
- 23
- 552
- 0
Investor Alert: Self-Directed IRAs and the Risk of Fraud pptx
... is available, it may not be audited Furthermore, self-directed IRA custodians usually not investigate the accuracy of this financial information This lack of available information for alternative ... financial and other information necessary to make a prudent investment decision may not be as readily available for these alternative investments Even when financial information for these alternative ... custodians or trustees of these accounts likely have not investigated the securities or the background of the promoter There are a number of ways that fraud promoters may use these weaknesses and misperceptions...
- 5
- 431
- 0
The Risk of Obstructive Lung Disease by Previous Pulmonary Tuberculosis in a Country with Intermediate Burden of Tuberculosis potx
... based on the classification of the National Tuberculosis and Respiratory Disease Association of the USA (14) Statistical analysis Comparisons between variables were tested using the chi-square test ... feedback to the technicians All data were saved for further analysis Even though the ATS recommendations require three or more acceptable curves for an adequate test, this is not practical for a ... fibrosis and inflammation may play important roles TB infection is associated with airway fibrosis and the immune response to mycobacteria could cause airway inflammation, a characteristic of obstructive...
- 6
- 441
- 0
Work-Related Health Limitations, Education, and the Risk of Marital Disruption pdf
... service (for men), age at marriage, a measure of cognitive performance, marital duration, religion, mother’s education, stability of parental marriage, age, premarital cohabitation, number of siblings, ... limitations in amount of work The probabilities of marital dissolution were evaluated at the following covariate values for each race-gender group: respondent was not in the military and was not a ... statistics for respondents separately according to race and gender The values presented are for personyears and represent the average value for each variable over all the person-years included for a particular...
- 14
- 452
- 0
Reducing the Risk of Breast Cancer With Medicine: A Guide for Women potx
... drinks a day raises the risk Other risk factors It is rare, but some women are born with a gene that puts them at high risk for breast cancer Having radiation treatment at a young age also raises the ... Cancer Risk Factors Age Getting older raises the risk of breast cancer Family history Having a mother, sister, or daughter who had breast cancer raises the risk Breast biopsy history Having an abnormal ... her age and other risk factors Most women who get breast cancer have no risk factors other than growing older And many women who have risk factors other than age never get breast cancer The chart...
- 16
- 400
- 0
Risk of cancer from diagnostic X-rays: estimates for the UK and 14 other countries docx
... survivors.7 The lung cancer model included parameters for sex and attained age All other models included parameters for sex and age at exposure, and for leukaemia and breast cancer attained age was also ... mortality rates were available from the same sources as for the UK—namely, Australia, Canada, Croatia, Czech Republic, Finland, Germany, Japan, Kuwait, Netherlands, Norway, Poland, Sweden, Switzerland, ... in the UK, about 20% of cancer cases are diagnosed in those aged 75 years and older Therefore, the total annual number of cases of cancer attributable to diagnostic X-rays at all ages in the...
- 7
- 700
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25