where the company is the trustee venturer for the loss to be attributed to non

HEPATOCYTE GROWTH FACTOR IS a MAJOR CYTOKINE FOR NSC HOMING TO GLIOMA

... activator (uPA) and urokinase plasminogen activator receptor (uPAR) are up-regulated in invasive tumors In the study by Gutova et al [48], they reported that activation of uPA and uPAR in brain, ... (ES) can be induced to become neural progenitors in vitro by retinoic acid When transplanted into mouse brain, neural progenitors migrate towards areas of inflammation and damage Neural progenitors ... method for treating the fatal glioma When injected directly into the brain or into the vein of the mouse model, NSCs migrate towards glioma [29, 30], medulloblastoma [31, 32], and melanoma brain...

Báo cáo y học: " Is there a protective effect of normal to high intellectual function on mental health in children with chronic illness" docx

Danh mục: Báo cáo khoa học

... contributions HKR has been responsible for the data analysis and the writing of the manuscript AJL designed and coordinated the study, supervised the data analysis and the writing process MH has been responsible ... children with a FSIQ-level of 85 or above This finding is in accordance with the results of Goodman and collaborators, showing that healthy children with low IQ within the normal range (defined as WISC-R ... discussed with the psychiatrist in charge of the training procedure In the present study we defined a psychiatric disorder as any definite diagnosis As part of the Kiddie-SADS-PL-interview the...

Tài liệu Báo cáo khoa học: Is ATP binding responsible for initiating drug translocation by the multidrug transporter ABCG2? docx

Danh mục: Báo cáo khoa học

... data show a 90% decrease in the amount of [3H]daunomycin bound to the membranes, indicating that the capacity for substrate interaction is considerably reduced The potency for vanadate trapping ... returned to high afﬁnity, and the intervening steps in the catalytic cycle are responsible for the restoration of binding capacity In order to maintain ABCG2R482G in a stable post-hydrolysis conformation, ... employed the vanadate trapping procedure The data revealed that vanadate-trapped ABCG2R482G protein ([E]Æ[ADP]Æ[Vi]) remained in a low-afﬁnity [3H]daunomycin binding conformation By inference, therefore,...

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Danh mục: Báo cáo khoa học

... Nucleolin was ﬁrst described as a major nuclear protein consisting of a negatively charged N-terminal domain, an RNA-binding domain and a C-terminal domain rich in RGG motifs [54] Nucleolin has been ... inevitable partial degradation of nucleolin, mean that calculations of binding afﬁnity are unrealistic at this stage Nucleolin localization in muscle is analogous to PTPr ligand localization To ... staining of retinal basement membrane using biotinylated HB-19 peptide Preincubation with lactoferrin and HB-19 abolishes FN3d–AP binding to muscle tissue [asterisks in (A) and (B), and (C) and...

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Danh mục: Báo cáo khoa học

... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast ... 8, the AAA domain helix and the C-terminal helix) However, the majority of these proteins are likely to be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, ... contains the b domain (b strands and 8), the ﬁnal helix of the AAA domain (a helix 10) and the C-terminal helix (a helix 11) This C-terminal region of Vps4 has been deﬁned in the PFAM database as...

High Remittance Costs in Africa: Is Building Regulatory Capacity for Microfinance Institutions the Answer? doc

Danh mục: Cao đẳng - Đại học

... subagent of banks in processing - “Upstreaming” of MFIs into the formal financial sector Leading MFIs are maturing both financially and operationally, in many cases transforming into banks or formal ... per cent) MFIs, Sub-Saharan Africa ranks second, far ahead of Latin America and Caribbean – high- Ensure financial sustainability lighting the limited presence of MFIs globally MFIs today mostly ... role in the assistance of start-ups and nurturing of maturing but not yet autonomous MFIs Capital market deals in the last two to three years are more evidence of the increasing “mainstreamization”...

Báo cáo khoa học: The highly conserved extracellular peptide, DSYG(893–896), is a critical structure for sodium pump function docx

Danh mục: Báo cáo khoa học

... ouabain binding (B) By plotting the reciprocal binding of [3H]ouabain against the K+ concentration, the EC50 for K+ can be obtained from the intercept of the straight lines with the abscissa Binding ... K+-transporting P-type ATPases Similar amino acids are not found in the Ca2+ ATPases or in the Na+ ATPases The Tyr895 is replaced with a phenylalanine (Phe910) in Hydra *The numbering here takes into ... acid is unlikely to be directly involved in ouabain binding As Asp893 is within an area of the protein that interacts with the b subunit [1,2], and because the b subunit has been shown not only to...

Báo cáo Y học: Arginine 121 is a crucial residue for the speciﬁc cytotoxic activity of the ribotoxin a-sarcin potx

Danh mục: Báo cáo khoa học

... [18,19] The behaviour of a- sarcin against ApA as a function of pH, altogether with the characterization of the individual pKa values of the active site residues, were consistent with the existence ... corresponding to Arg121 side-chain has a dramatic effect on the a- sarcin–membrane interaction Regarding to this, the region ˚ around Trp51, located at around 11 A from position 121, is involved in the ... very similar result has been obtained before for the H50Q variant, while mutation of either Glu96 or His137, residues acting as the general acid and base on the catalysis by a- sarcin [19,20],...

báo cáo hóa học: " Is dental amalgam safe for humans? The opinion of the scientific committee of the European Commission Joachim Mutter" pdf

Danh mục: Hóa học - Dầu khí

... there are many hints that mercury plays the major pathogenetic role in AD [44] Maternal amalgam as the main source of mercury in infant tissues Maternal amalgam fillings lead to a significant increase ... Yoshida M, Watanabe C, Satoh M, Yasutake A, Sawada M, Ohtsuka Y, Akama Y, Tohyama C: Susceptibility of Metallothionein-Null Mice to the Behavioural Alterations Caused by Exposure to Mercury Vapour ... fillings with amalgam and amalgam fillings under crowns were not calculated As an allegedly non- amalgam group, they were compared with individuals who still had teeth with amalgam fillings The authors...

Báo cáo hóa học: " Our vision for this new SpringerOpen Access journal, Psychology of Well-Being: Research, Theory and Practice, is to promote a distinctly eclectic approach to investigating well-being. When the prospect of " pdf

Danh mục: Hóa học - Dầu khí

... has been instrumental in understanding the factors that are associated with well-being For example, we now have considerable insight into the role of personality and sociodemographic factors in ... technologies, can be developed for individuals across the lifespan and across the globe This is an inter-disciplinary task The scientific research community is considerably more accepting of well-being ... demand for well-being programs is high and scientists, in partnership with practitioners, need to take a lead in providing the public with valuable and practical knowledge Therefore, we have a responsibility...

Báo cáo khoa học: " The median non-prostate cancer survival is more than 10 years for men up to age 80 years who are selected and receive curative radiation treatment for prostate cancer" ppt

Danh mục: Báo cáo khoa học

... from non- prostate cancer death for men treated with radiation treatment The bottom line is the median survival at the same age for the male population of British Columbia, Canada Discussion We have ... 82 Age at start of radiation treatment Figure Median survival at age of starting radiation treatment Median survival at age of starting radiation treatment The top line is the median survival ... mortality can be adjusted for competing risks [7] Our finding that the cumulative mortality risk is lowered after adjustment for competing risks is in accordance with the findings of Satagopan...

Báo cáo y học: " There has been a lack of investigation into the spatial distribution and clustering of suicide in Australia, where the population density is lower than " pot

Danh mục: Báo cáo khoa học

... was applied as a reference to combine the SLAs into LGAs MapInfo 9.0 was used as a platform to perform the data linkage, transfer and spatial display Population data in total, by gender and age ... time-consuming and computation intensive to calculate the age-standardised mortality (ASM) rates at a Statistical Local Area (SLA) level, we used the aggregated data to examine the feasibility of linking ... Brisbane City had 163 SLAs in 2001), and in rural and remote areas that make up the majority of Queensland territory, each LGA is also an SLA The LGA information, including name, code and area...

báo cáo khoa học: " Medicines and vaccines for the world''''s poorest: Is there any prospect for public-private cooperation?" ppt

Danh mục: Báo cáo khoa học

... lucrative markets of the future the Malaria Vaccine Initiative and the Medicines for Malaria Venture [19] The pharmaceutical firms' primary mission is to maximize shareholder value They are partially ... rights to any future vaccine What Is in it for Pharmaceutical Companies? Why are pharmaceutical companies willing to participate in these partnerships? There are many reasons First, in some cases they ... Priorities What are the major conclusions? It appears that the resource gap that is perceived as the main obstacle to access to drugs is shrinking In part, this is due to an increased flow of...

Báo cáo khoa học: "Is there a place for N-acetylcysteine in the treatment of septic shock" pptx

Danh mục: Báo cáo khoa học

... microcirculation and thus oxygen extraction, while at the same time attenuating inflammatory responses Prostacyclin, a prostaglandin synthesized in endothelial cells, is a potent vasodilator and an inhibitor ... injury was decreased, however, and there was also a significant increase in the cardiac index in the NAC-treated group [20] Conclusions This is an exciting time for intensivists involved in the care ... TNF-α and IL-6 and reduced the mortality rate in premature infants with sepsis [13] NAC in animal experimental and human sepsis NAC increases nitric oxide synthesis and cGMP Several studies have...

Báo cáo y học: " Incorporation of podoplanin into HIV released from HEK-293T cells, but not PBMC, is required for efficient binding to the attachment factor CLEC-2" ppsx

Danh mục: Báo cáo khoa học

... E18 7A, 5'-GTTTTTGGAAGATGGAGCCGGAAATATGAATTGTG-3' (sense) and 5'-AATTCATATTTCCGGCTCCATCTTCCAAAA3' (antisense) for mutant CLEC-2 K19 0A, 5'-GCAACATTG TGGAATATATTGCGGCGCGCACCCATCTGATTC-3' (sense) and ... H, Kameyama A, Ogasawara S, Matsuura N, Hasegawa Y, Suzuki-Inoue K, Inoue O, Ozaki Y, Narimatsu H: Molecular analysis of the pathophysiological binding of the platelet aggregationinducing factor ... terminator sequence The shRNA was constructed by annealing shRNA137sense_BamHI: 5'GATCCGCGAAGATGAT GTGGTGACTTTCAAGAGAAGTCACC ACATCATCTTCGTTTTTTACGCGTG3' and shRNA137antisense_EcoRI: 5'AATTCACGCGTAAAAA...