virus hepatitis b and hepatitis c virus infections among injecting and non injecting drug users in inner city neighborhoods
Báo cáo y học: "Association between expatriation and HIV awareness and knowledge among injecting drug users in Kabul, Afghanistan: A cross-sectional comparison of former refugees to those remaining during conflict" ppsx
... purposes) Conflict and Health 2007, 1:5 http://www.conflictandhealth.com/content/1/1/5 Table 1: Correlates of living outside Afghanistan in the last decade among injecting drug users in Kabul (n = 463) ... programs in post-conflict settings [25-27] Returning refugees should receive special attention as injecting is believed to be an imported behavior and returning refugees engage in high-risk injecting ... 1:5 http://www.conflictandhealth.com/content/1/1/5 Table 3: Specific HIV knowledge among injection drug users in Kabul, Afghanistan Question Topic Correct Knowledge %, (n) HIV infectious forever...
- 8
- 233
- 0
báo cáo khoa học: " Prevalence and correlates of HIV, syphilis, and hepatitis B and C infection and harm reduction program use among male injecting drug users in Kabul, Afghanistan: A cross-sectional assessment" ppsx
... needles/syringes ever and in the last three months, sharing injecting “works” (e.g cookers, cotton) ever and in the last three months, duration of injecting, injecting while incarcerated, aspirating and ... summary, both injecting drug use and NSP utilization appear to be increasing in Kabul, Afghanistan Injecting has become an accepted and popular route of drug administration, tied to many factors, ... Table Variables independently associated with HIV and hepatitis < /b> B and C infection in logistic regression analysis among a cohort of male injecting drug users in Kabul, Afghanistan (N = 483) Continuous...
- 8
- 374
- 0
báo cáo khoa học: " A review of the evidence for the effectiveness of primary prevention interventions for Hepatitis C among injecting drug users" potx
... Discussion and conclusion Reducing the incidence of HCV continues to present a considerable challenge Recent UK based research conducted amongst injecting drug users documented an incidence rate ... increase in distribution Such increase in distribution does not lead to an increase in injecting drug use or a switch from non -injecting to injecting [39,40] Cost-effectiveness of needle exchange programmes ... attributable to injecting drug use Abbreviations BBV – blood borne virus < /b> ELISA – enzyme-linked immunosorbent assay HCV – Hepatitis < /b> C HIV – Human immunodeficiency virus < /b> IDUs – injecting drug users...
- 9
- 322
- 0
báo cáo khoa học: " ’It’s risky to walk in the city with syringes’: understanding access to HIV/AIDS services for injecting drug users in the former Soviet Union countries of Ukraine and Kyrgyzstan" ppt
... those groups Obstacles included locating and identifying IDUs who were circumspect about being approached by researchers unknown to them outside of HIV/AIDS service settings, since they believed this ... accessing different NGO services A Ukrainian client described an ‘ informal and confiding atmosphere’ and the way staff were attentive, sympathetic and non- discriminating The maintenance of confidentiality ... reproduces discriminatory practices among law enforcement officers and service providers; economic and geographical barriers exaggerated by stigma, discriminatory practices and factors impacting on the...
- 15
- 477
- 0
báo cáo khoa học: " Social-structural contexts of needle and syringe sharing behaviours of HIV-positive injecting drug users in Manipur, India: a mixed methods investigation" doc
... by police and a strong military and paramilitary presence in Manipur [11,13,14] In India, narcotic substances, such as opium, coca leaf and psychotropic substances specified in the Narcotic Drugs ... Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit ... disadvantage; specific injecting environments such as prisons; social stigma and discrimination; policies, laws and policing; and complex emergencies such as armed conflict [29] With the exception of...
- 10
- 272
- 0
báo cáo khoa học: " HIV and hepatitis C virus infections among hanka injection drug users in central Ukraine: a cross-sectional survey" ppt
... were ineligible due to the absence of physical drug injecting signs in combination with poor knowledge of the local IDU scene and practices and/ or unconvincing statements about personal drug ... opiate drugs (> years) increased the risk of HCV Recent Table 1: Prevalence of HIV and hepatitis < /b> C virus < /b> (HCV) infections among injection drug users in Vinnitsya, Ukraine HIV status # (%) HCV status ... http://www.harmreductionjournal.com/content/6/1/23 Table 2: Univariate analysis of categorical factors associated with HIV and hepatitis < /b> C virus < /b> (HCV) infections among injection drug users in Vinnitsya, Ukraine...
- 9
- 331
- 0
báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot
... nature and the risk factors of HCV, with advice on prevention including the need to reduce sharing of injecting equipment and safer injecting practices It was intended to be a non- interactive intervention ... maintenance and hepatitis < /b> C virus < /b> infection among injecting drug users Addiction 1997, 8:999-1005 Mathei C, Buntinx F, Van Damme P: Seroprevalence of hepatitis < /b> C markers among intravenous drug users in ... established by a combination of clinical assessment by service staff, and baseline research interview conducted by the research workers Ethical approval for the research was sought and obtained...
- 12
- 454
- 0
Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc
... of cytosolic cytochrome c ( 15 kDa) (C) Hepatic cytosolic fractions isolated from ETA-injected or DT-injected rats were incubated with fluorescent substrates speci c for caspase-9, caspase-3, and ... induced ADP-ribosylation of cytosolic EF-2 as well as the mitochondrial release of cytochrome c, both in vivo and in vitro, with the in vitro effects being substantially increased by cathepsin B ... bafilomycin-A1 were purchased from Calbiochem Bovine cathepsin D (EC 3.4.23.5, 15 UÆmg)1), bovine cathepsin B (EC 3.4.22.1, recombinant truncated human furin 10 UÆmg)1), (2000 UÆmL)1) and human...
- 15
- 588
- 0
Báo cáo y học: "Understanding the roles of the transcription factors nuclear κ α factor-κB and hypoxia-inducible factor-1α in lung injury" pptx
... [8–10] HIF-1 consists of two subunits HIF-1α, a DNAbinding protein, has increased stability and binding in hypoxic conditions and is degraded rapidly in normoxia The accumulation of the α-subunits ... models As exciting as this emerging field is, with its predictable contribution to future ‘bench to bedside’ discussions, a more complete mechanistic understanding and future clinical trials will ... transcription factors in the regulation of oxidant-mediated α lung injury: role for hypoxia-inducible factor-1α Crit Care 2003, 7 :in press Fein AM, Calalang-Colucci MG Acute lung injury and acute...
- 2
- 193
- 0
Báo cáo y học: " Caspase-3-mediated cleavage of p65/RelA results in a carboxy-terminal fragment that inhibits IκBα and enhances HIV-1 replication in human T lymphocytes" ppsx
... following primers: p65sNotI, 5'-TCGTAACAACTGCGGCCGCTTGACGCAAATGGGCGGT-3' and p65as, 5'-GCTGGATATCTGCAGAATTCCACC-3' Then, p65wt gene was cloned in pCMV-Tag1 plasmid using NotI/BamHI cloning sites ... with NF- B1 /p50 This can be explained because both subsites containing the residues that contact DNA present in each subunit of the dimer are necessary to bind the complex to the DNA backbone [44] ... Substrate (Pierce, Rockford, IL) Cytosolic and nuclear protein extracts were subjected to immunoprecipitation with specific antibodies In brief, 100 μg of nuclear or cytosolic proteins were incubated...
- 20
- 314
- 0
Báo cáo y học: "Genome-wide identification of novel expression signatures reveal distinct patterns and prevalence of binding motifs for p53, nuclear factor-κB and other signal transcription factors in head and neck squamous cell carcinoma" docx
... –CGTACACACCGTGTGCTGGGACACCCCACAGTCAGCCGCATGGCTCCCCT-CGTACACACCGTGTGCTGGGACACCCCACAGTCAGCCACATGGCTCCCCT-CGTCCACAGTGTGTCCTGGGACACCC CAGTCAGCTGCATGGCCTCCCT-CGTCCACACCGTGTCCTGGGACACCC CAGTCAGCTGCATGGCTTCCCT- ... –AGCGGAGCCTCCACCGCCCCCCTCATTCCCAGGCAAGGGCTTGGGGGGAA-AGCGGAGCCTCCACCGCCCCCCTCATTCCCAGGCAAGGGCTTGGGGGGAA-AGCGGAGCCTCCACCGCCCCCCTCATTCCCAGGCAAGGGCTTGGGGGGAA-AGCGGAGCCTCCACCGCCCCCCTCATTCCCAGGCAAGGGCTTGGGGGGAA- ... –ATTGCTTTAGCTTGGAAATTCCGGAGCTGAAGCGGCCAGCGAGGGAGGAT-ATTGCTTTAGCTTGGAAATTCCGGAGCTGAAGCGGCCAGCGAGGGAGGAT-ATTACTTCAGTTTGGAAATTCCTAGATCGCAGGGGCCAGCGAGGCAGGAC-ATTACTTCAGTTTGGAAATTCCTGGGTCGCAGGGGCCAGCGAGGCAGGAC- IL6 -76 (p65/cRel) -62 5’ –AAATGTGGGATTTTCCCATGAGTCTCAATATTAGAGTCTCAACCCCCAAT-...
- 25
- 349
- 0
Báo cáo y học: " Effectiveness of antiretroviral therapy and development of drug resistance in HIV-1 infected patients in Mombasa, Kenya" doc
... effectiveness of the NRTI backbone of second-line regimens that often include ABC and TDF Moreover, the limited availability and the high cost of boosted PIs force clinicians in RLS to recycle ... approval was obtained from the Kenyatta National Hospital Ethics and Research Committee Using a structured questionnaire, basic socio-demographic and clinical data was obtained from each participant ... reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright BioMedcentral Submit your manuscript here: http://www.biomedcentral.com/info/publishing_adv.asp...
- 4
- 384
- 0
báo cáo khoa học: " Knowledge of AIDS and HIV transmission among drug users in Rio de Janeiro, Brazil" doc
... hands, sharing injected and inhaled drugs, and having vaginal and anal sex The indirect interaction pictures included a person being bit by a mosquito and a person donating blood After observing ... HIV-risk behavior among injecting or non -injecting drug users in Cape Town, Pretoria, and Durban, South Africa Subst Use Misuse 2009, 44(6):886-904 Farmer P: Social inequalities and emerging infectious ... and that this pattern occurs among marginalized drug users as much as among individuals who embrace mainstream behavior sets Consequently, public health efforts must be particularly careful in...
- 10
- 270
- 0
báo cáo khoa học: " Assessing the role of syringe dispensing machines and mobile van outlets in reaching hard-to-reach and high-risk groups of injecting drug users (IDUs): a review" ppt
... and hence far more changes in injecting partners [56] Syringe exchange machines were found to be very effective in increasing access to sterile injecting equipment in prisons in Switzerland and ... and/ or mobile vans were identified by a comprehensive search of electronic databases such as Medline, Medscape, Current Contents, HealthSTAR, CAB Abstracts, Aidsline, Sociological Abstracts and ... recommends comprehensive NSPs including pharmacy involvement in distribution, strategically-placed dispensing machines and mobile exchanges Table 2: Standard of good practice of dispensing machine...
- 9
- 422
- 0
báo cáo khoa học: " The acceptability and feasibility of peer worker support role in community based HCV treatment for injecting drug users" pot
... D, Siebert U: Cost-effectiveness of treatment of HCV in injecting drug users In Hepatitis < /b> C and injecting drug use: impact, costs and policy options Edited by: Jager J, Limburg W, Kretzschmar ... Turning Point Alcohol and Drug Centre's clinical services Turning Point is a multidisciplinary drug and alcohol outpatient treatment service in Fitzroy, an inner city neighbourhood of Melbourne ... situated in alternative settings such as drug treatment clinics where large numbers of injecting drug users could potentially better access services The Healthy Liver Clinic (HLC) was established in...
- 9
- 303
- 0
báo cáo khoa học: " Predictors of HIV infection and prevalence for syphilis infection among injection drug users in China: Community-based surveys along major drug trafficking routes" pps
... drug users in Xinjiang, China J Infect 2007, 54(3):285-290 Wu Z: Recent trends of injecting drug use and related HIV infection in China Global Research Network Meeting on HIV Prevention in Drug- Using ... true background rate among IDUs in the study community Second, recall bias and social desirability bias are possible, since the drug use and sexual behavioral information was collected based ... large outbreak of HIV in China was identified in 1989 among injection drug users (IDUs) in Dehong Prefecture of Yunnan Province on the Myanmar (Burma) border in southwest China [7] The specific HIV...
- 11
- 219
- 0
báo cáo khoa học: " A qualitative exploration of prescription opioid injection among street-based drug users in Toronto: behaviours, preferences and drug availability" pdf
... F, Pajusco B, Sarti M, Talamini G, Lechi A, Mezzelani P, Des Jarlais DC: Factors associated with hepatitis < /b> C virus < /b> infection in injection and noninjection drug users in Italy Clin Infect Dis 2003, ... documented in the literature, particularly within the context of heroin use [19-21] Factors associated with transitioning from non -injecting to injecting have included demographic characteristics such ... to be characterized by unstable housing, criminal activity, health problems and injection risks compared to non- co -users of crack [4] In addition to poly-substance use, the diversification of drug...
- 10
- 194
- 0
báo cáo khoa học: " Seroprevalence of select bloodborne pathogens and associated risk behaviors among injection drug users in the Paso del Norte region of the United States – Mexico border" ppt
... participants in Mexico and 9.9% in Texas using RDS calculations compared with New Mexico's crude calculation of 3.0% All categorical variables – including sociodemographic and risk behavior information ... and resources including Programa Compañeros, A .C in Ciudad Juárez; Camino de Vida in Las Cruces, New Mexico; Families and Youth, Incorporated in Las Cruces, New Mexico; Mainstreet Methadone Clinic ... Tattoos, incarceration and hepatitis < /b> B and C among street-recruited injection drug users in New Mexico, USA: update Epidemiol Infect 2005, 133:1146-1148 Bucardo J, Brouwer KC, Magis-Rodriguez C, Ramos...
- 9
- 365
- 0
báo cáo khoa học: " Comparison of injecting drug users who obtain syringes from pharmacies and syringe exchange programs in Tallinn, Estonia" doc
... frequencies [29,30] New injectors create special problems for HIV prevention Studies have found higher rates of injecting risk behavior and a higher incidence of blood-borne infections among new injectors ... 28 29 30 Thein HH, Denoe M, van Beek I, Dore G, MacDonald M: Injecting behaviour of injecting drug users at needle and syringe programmes and pharmacies in Australia Int J Drug Policy 2003, 14:425-430 ... geographical origin and clinical stage including a unique seroconversion panel J Clin Microbiol 1998, 70:139-151 Victora CG, Huttly SR, Fuchs SC, Olinto MT: The role of conceptual frameworks in epidemiological...
- 8
- 295
- 0
báo cáo khoa học: " Psychosocial and contextual correlates of opioid overdose risk among drug users in St. Petersburg, Russia" pot
... accessible and bountiful source of heroin, which is administered primarily by injection [2-4] Consequently, injection-associated infections such as HIV and hepatitis < /b> C virus < /b> are increasing among ... depressants in combination with opioids, injecting a small preliminary dose to judge the strength of the drug) Responses were independently coded by two researchers (TCG, KB) for content and accuracy ... should inform drug users that this strategy is impossible in practice when using heroin since drug strength can vary substantially The study findings also indicated that St Petersburg drug users...
- 11
- 328
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25