use of umbilical venous blood on assessing the biochemical variations of acid base nutritional and metabolic parameters on growth retarded fetuses in comparison with gestational control cases a study
Báo cáo hóa học: " Use of Time-Frequency Analysis and Neural Networks for Mode Identification in a Wireless Software-Defined Radio Approach" pptx
... transmit a large number of modes in different bands The SDR approach is a great evolution based on the programmable digital radio (PDR) paradigm, which consists in a radio fully programmable in baseband ... Van Dyck, and A Soltanian, “Interference of bluetooth and IEEE 802.11: simulation modeling and performance evaluation,” in Proc 4th International ACM Workshop on Modeling, Analysis and Simulation ... extraction Preprocessing Classification Baseband reconfigurable processing (a) Received signal RF stage ADC TF Analysis Features extraction Classification Baseband reconfigurable processing Mode...
- 13
- 455
- 0
Báo cáo y học: "Clinical observations on intensive immunosuppressive therapy combined with umbilical cord blood support for the treatment of severe aplastic anemia" ppt
... data interpretation; ZY collected patient data and samples; YF collected patient data and samples; FKperformed the statistical analysis All authors have read and approved the final manuscript Conflict ... clinical observations procedures, designed and coordinated the study, interpreted data and wrote the manuscript; LG collected patient data and samples, assisted with statistical analysis and data ... article as: Zhou et al.: Clinical observations on intensive immunosuppressive therapy combined with umbilical cord blood support for the treatment of severe aplastic anemia Journal of Hematology & Oncology...
- 2
- 316
- 0
A study on the use of language activities to enhance 11th grade student's speaking skill in pham hong thai school, hung nguyen district, nghe an province
... fluency Accuracy in language teaching involves the correct use of vocabulary, grammar and pronunciation In controlled and guided activities, accuracy is usually the focus and the teacher makes it ... of language teaching and learning Bloom himself maintained that The major purpose in constructing a taxonomy of educational objectives is to facilitate communication Darn (2008) said that classroom ... materials that they are learning In addition, student comprehension or seat work is not monitored on a regular basis In contrast, strong and consistent management and organizational skills have...
- 98
- 807
- 6
Báo cáo sinh học: "The use of fixed effect models and mixed models to estimate single gene associated effects on polygenic traits" pot
... generation offspring only may cause an additional problem because of limited segregation of the investigated gene within offspring sharing proportions of a common additive ancestor genotype The ... the pedigree of the investigated individuals must be traced back to a common ancestor base population In many cases, the parents of the first experimental generation may be regarded as the base ... individuals and their common ancestors during the last preceding generations If the total number of individuals with and without records in the analysis is n’, the dimension of the extended A will...
- 13
- 196
- 0
AN ENGLISH GRAMMAR FOR THE USE OF HIGH SCHOOL, ACADEMY, AND COLLEGE CLASSES pot
... inflections and formulation of rules Mental training An æsthetic benefit Grammar is eminently a means of mental training; and while it will train the student in subtle and acute reasoning, it will at the ... (German Gans, Icelandic gás, Danish gaas, etc.) The masculine was formed by adding -a, the old sign of the masculine This gansa was modified into gan-ra, gand-ra, finally gander; the d being inserted ... express the condition of a poor person; proof means the act of proving, or that which shows a thing has been proved; and so on Again, we may say, "Painting is a fine art," "Learning is hard to acquire,"...
- 386
- 640
- 1
Báo cáo khoa học: "Effects of irrigation and nitrogen fertiliser on the growth and nutrient relations of Prunus avium L and ’Colt’ (Prunus avium x Prunus pseudocerasus) in the nursery and after transplantation" doc
... influence on P and K concentration and a negative influence on Ca and Mg concentration in the leaves Trickle irrigation has been shown to increase the concentration of extractable P in the soil (Bacon ... relations and even less information is available on the influence of irrigation on seedling nutrient relations and subsequent growth and survival after outplanting (Duryea and McClain, 1984) MATERIALS ... effect on the growth of the trees in 1990 Irrigation in 1989 caused an increase Nitrogen The irrigation of the transplanted trees in 1990 (table VII) had a large influence on the concentration of all...
- 13
- 358
- 0
Báo cáo khoa hoc:" Combined use of maxillomandibular swing approach and neurosurgical ultrasonic aspirator in the management of extensive clival chordoma: A case report" pptx
... worsening right-sided nasal blockage of one year duration, with two episodes of epistaxis and deterioration of vision On examination there was a mass in the right nasal cavity extending across the ... performed without injury of the structures within the dural space i.e brainstem, basilar Figure Sagittal and axial views of brain MRI scan Sagittal and axial views of brain MRI scan Image shows ... the case of an adolescent patient with a large clival chordoma with resection using a maxillomandibular swing approach and ultrasonic aspirator Case presentation A 17 year old boy presented with...
- 4
- 456
- 0
báo cáo khoa học: " Trends in beliefs about the harmfulness and use of stop-smoking medications and smokeless tobacco products among cigarettes smokers: Findings from the ITC four-country survey" pdf
... shows the usage of stop-smoking medications and SLT in the four countries at each wave Use of NRT declined after wave in Canada, the UK, and Australia and after wave in the US Use of any SSMs increased ... in Australia and New Zealand and all European Union countries other than Sweden It has remained available in the US and Canada Despite this, most smokers are misinformed about the safety and ... JC conducted the statistical analysis and drafted sections of the manuscript RB, AM, RO’C, and KMC participated in the design of the study and the interpretation of the results All authors participated...
- 11
- 287
- 0
The relationship between the use of vocabulary learning strategies and learner autonomy of the first year non-major English students at Thainguyen University of Technology
... Language Learning and Language Teaching London: Chapman and Hall 11 Creswell, J W (2005) Educational Research: Planning, conducting and evaluating quantitative and qualitative research Upper Saddle ... between the use of students’ vocabulary learning strategies and the learner autonomy is Aims of the study The study is aimed at improving the use of vocabulary learning strategies and the learner autonomy ... data and discusses findings Part C: Conclusion This part recaps the main content of the study and deals with some suggestions for improving the use of vocabulary learning strategies as well as...
- 5
- 472
- 1
The use of credit scoring models and the importance of a credit culture
... estimate annual and cumulative defaults 10 Marginal and Cumulative Mortality Rate Equation MMR(t) = Total value of defaulting debt in year (t) total value of the population at the start of the year ... Construction and Engineering Paper Telecommunications Containers and Packaging Retail 41 Z”-score and Equivalent Bond Rating Z" − Score = 3.25 + 6.56 * BV of Equity Working Capital Retained Earnings ... Empresas ICA Sociedad Controladora Grupo Televisa SA Kimberly-Clark de Mexico Telefonos de Mexico SA de CV Vitro SA de CV n .a: not available BBBBB+ BB BB+ Dec 94 n .a AAA BBBABBB AA AAA AAA BB+...
- 90
- 916
- 0
THE USE OF ICTS FOR FUNDRAISING AND AWARENESS RAISING IN NGOS OF THE GLOBAL SOUTH AN ANALYSIS OF STRATEGIES OF NGOS IN NEPAL
... selfsustainability, isolation and low inter-organizational communication and coordination, small-scale interventions, and minimal understanding of broader social and economic context are frequent drawbacks ... Relationships with the State and International Organizations Relationship Indicators Working with state only Working with neither Working with both 0%(0) Working with international organizations ... expresses information, learning, and adaptation are as much foundation of economies as physical capital and human skill accumulation, projecting information as development‟s “engine” 18 HealthNet linked...
- 195
- 960
- 0
DEVELOPMENT OF a BLUEPRINT FOR COMPUTER BASED TRAINING (CBT) IN THE USE OF ELECTRONIC CHART DISPLAY AND INFORMATION SYSTEMS (ECDIS)
... STATUS INDICATIONS, INDICATORS AND ALARMS FOR DIFFERENT KINDS OF SITUATION AND TAKE PROPER ACTION 13.1 DEFINITION AND MEANING OF INDICATORS AND ALARMS Outline the definition and meaning of status indications, ... understanding of the equipment, including appreciation of its advantages and limitations, and his confidence in its operation and application reduces the chances of navigational errors that may lead ... competency are stated as The charts selected are the largest scale suitable for the area of navigation and charts and publications are corrected in accordance with the latest information available” In...
- 62
- 405
- 1
Báo cáo y học: "Maternal use of Loratadine during pregnancy and risk of hypospadias in offspring"
... County) and January 1, 1998 (Ringkoebing and Viborg counties) Drugs sold over the counter are not available in these Prescriptions databases Among cases and controls, prescriptions on loratadine (ATC ... hypospadias and 2270 matched controls when considering diagnosis within six months postpartum Descriptive data for cases and controls are shown in Table A total of one case and eight controls ... stillbirth, Apgar score, gestational age, height and weight of the neonate, and personal identifiers for both mother and child [24] Use of loratadine, other antihistamines, IVF drugs, antidiabetics and...
- 5
- 528
- 0
Báo cáo Y học: The function of methyl-menaquinone-6 and polysul®de reductase membrane anchor (PsrC) in polysul®de respiration ofWolinella succinogenes doc
... incorporated instead, the activity was as low as that of proteoliposomes prepared without added quinone In liposomes containing fumarate reductase and hydrogenase, fumarate respiration with H2 was ... K1 as the standard MK4 (Sigma; cat no V-9378) and vitamin K1 (Fluka; cat no 95271) are commercially available Activities of Psr and of polysulđde respiration The activity of Psr was measured at ... liposomes containing increasing amounts of MM The six different preparations so obtained contained equal amounts of phospholipids from the membrane fraction and from the liposomes The activity of polysulđde...
- 10
- 490
- 0
Báo cáo lâm nghiệp: "Influence of flooding on growth, nitrogen availability in soil, and nitrate reduction of young oak seedlings (Quercus robur L.)" docx
... amino acid concentrations than that of control cotyledons (Fig 6) After drainage the flooded cotyledon amino acid content was similar to that of the control seedlings (Fig 6) DISCUSSION 4.1 Growth ... However, after drainage this amino acid pool decreased below that of control taproots (Fig 6) On account of a small quantity of flooded lateral roots, their amino acid content was measured only after ... day 34 After drainage, ammonium concentration became similar between the two treatments Whatever the treatment, ammonium concentrations in taproot and nitrate concentrations in leaves remained...
- 8
- 282
- 1
Báo cáo y học: "Organic farmers use of wild food plants and fungi in a hilly area in Styria (Austria)." docx
... leaves", "preparation as a salad", "preparation as a soup", the "rare listing" and "rare gathering of the plant or mushroom", "gathering from meadows" and "gathering in spring" CoP -A matches with this ... facilitates the evaluation of the culinary importance of species and of the significance of distinct ways of preparation in the research area Furthermore, this index makes the comparison of the relative ... http://www.ethnobiomed.com/content/6/1/17 Rosaceae (6 species), followed by Brassicaceae and Asteraceae (3 species each), then Lamiaceae, Plantaginaceae, Boletaceae, Agaricaceae, Russulaceae and Ramariaceae (2 species...
- 14
- 414
- 0
báo cáo khoa học: " Characterization and analysis of the cotton cyclopropane fatty acid synthase family and their contribution to cyclopropane fatty acid synthesis" pot
... tcccTTAATTAA a t g a a a a t a g c a gtgataggagga GCPS3-3’XbaI: GCTCTAGA t t a a g a a g c t g a g g ggaagtcttt Tobacco BY2 transformation GCPS3-5’XbaI: GCTCTAGA a t g a a a a t a g c a g t gataggagga ... optimizing the accumulation of CPAs CPAs have physical characteristics somewhere in between saturated and mono unsaturated fatty acids The strained bond angles of the carbocyclic ring are responsible ... qGCPS-1F(5’- TTAAGTGGTCAACCGGCCATGCAA -3’) and qGCPS-1R (5’-TTCTTTGGACTGGGCGGAACAGAA -3’), qGCPS2-1F (5’-ATATTCCCTGGAGG AACC CTG CTT-3’) and qGCPS2-1R (5’-AAACCG GCAGCGCAGTAATCGAAA-3’) for GhCPS2, and qGCPS3-1F...
- 10
- 324
- 0
báo cáo khoa học: " The syringe gap: an assessment of sterile syringe need and acquisition among syringe exchange program participants in New York City" pot
... have no competing interests Authors' contributions DH designed the study, managed data collection, assisted with data analysis, and wrote the manuscript DP assisted with data analysis and manuscript ... drug users regarding individual drug use and injecting patterns at each transaction [37] Finally, although politically controversial, the potential for establishing safe injecting facilities in ... citation purposes) Harm Reduction Journal 2009, 6:1 ing a public bathroom, an apartment hallway, a park, a rooftop, a subway station, and a bank machine enclosure When public injecting was converted...
- 8
- 269
- 0
Báo cáo y học: "Clinical review: The meaning of acid–base abnormalities in the intensive care unit – effects of fluid administration" potx
... effects of ATOT infusion As a result the overall tendency of standard albumin and gelatin based colloids to cause metabolic acidosis is probably similar to that of saline By contrast, hetastarch and ... becomes the independent variable Total concentration of weak acid (ATOT) Body fluid compartments have varying concentrations of nonvolatile (i.e non-CO2) weak acids In plasma these consist of albumin ... and pentastarch are not weak acids, and the SID of standard starch preparations is zero (Table 6) Their acid base effects are therefore likely to be similar to those of saline and the weak acid...
- 8
- 404
- 0
Báo cáo khoa học: "Clinical review: The meaning of acid–base abnormalities in the intensive care unit – epidemiolog" ppt
... resuscitation but also as an important variable in the quantification and determination of the primary etiology of a metabolic acidosis In the presence of a metabolic acidosis and a normal lactate and ... mortality in the critically ill is not as clear as that of lactate There have been varying findings regarding absolute values and the significance of all quantitative acid base variables, especially ... traditional anion gap differ in the sense that the traditional anion gap exists in a broad ‘range’ of normal values, whereas the SIG takes into account the effect of a wider range of ions, including...
- 9
- 371
- 0
- fce use of english 2 book and key
- guidance for the use of u s customary and si units in the asme boiler and pressure vessel code
- making use of symbols nested elements and grouping
- use of economic capital measures and governance
- making use of http chunked responses and timers
- use of critical alignment processes and indicators
- 1 5 use of a personal computer and matlab
- an overview use of traditional antiarthritic drugs and update on drug development
- use of chemically modified chitosan and other natural origin polymers in tissue engineering and drug delivery
- 4 combined use of bioassay guided fractionation and sars to identify allergens in fragrance complex mixtures
- a question of solving key nutritional and metabolic constraints on mammalian brain development
- current use of electronic financial systems and electronic dental records
- combined use of f 18 fluorodeoxyglucose and c 11 methionine in 45 pet guided stereotactic brain biopsies
- 1 gaseous and acid base parameters in umbilical venous blood table 4 1 fig 4 1
- 2 metabolic parameters in umbilical venous blood table 4 2 fig 4 2
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008