1 5 use of a personal computer and matlab

... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... important function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3 .1. 1 Copyright  2003,...

Ngày tải lên: 21/12/2013, 19:15

... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... important function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3 .1. 1 Copyright  2003,...

Ngày tải lên: 18/01/2014, 04:20

... ensure appropriate selection EXPLAIN ALL SAFETY-RELEVANT AS WELL AS OTHER MAJOR CHARACTERISTICS OF ECDIS DATA SUCH AS DATA CONTENTS, HANDLE ECDIS DATA ON BOARD AND ASSESS ALL ERRORS, INACCURACIES AND ... position of antenna and transducer) 1. C .a 5. 4 SELECTION OF APPROPRIATE AND UNAMBIGUOUS SENSOR DATA Explain the need for selection of appropriate and unambiguous sensor data displayed in ECDIS 5. 5 PLAUSIBILITY ... of and ability to use navigational charts and publications, …” Criteria for evaluating competency are stated as “The charts selected are the largest scale suitable for the area of navigation and...

Ngày tải lên: 09/05/2016, 16:54

... verb, an adjective, a phrase or Pour in 12 5g melted butter, beaten eggs and teaspoon another adverb Basing on the data analysis, we found that adverbs of vanilla essence manner, adverbs of time and ... of quantity can convey 4 .1. 1 Adverbs by means of numbers [1, p. 91] Adverbs are words that add more information about manner, time, 4 .1. 2 .1 Cardinal Numbers place, circumstances and so on to a ... products as well as What are lexical, syntactic, and semantic features of instructions for use of foodstuffs in English and Vietnamese? What are similarities and differences of instructions for use of...

Ngày tải lên: 26/11/2013, 13:23

... Wild-type M149K N 152 D G 155 P, K 156 S, G 157 E N 152 D, G 155 P, K 156 S, G 157 E G 155 K, D ( 15 6 15 7), A 158 E M149K, G 155 K, D ( 15 6 15 7), A 158 E N 152 D, G 155 K, D ( 15 6 15 7), A 158 E M149K, N 152 D, G 155 K, D ( 15 6 15 7), A 158 E 74 ... I13 7A I13 8A N13 9A D14 0A W14 1A V14 2A K14 3A T14 4A H14 5A T14 6A K14 7A M14 9A N 152 A E28 3A E28 5A K32 5A K32 7A PAI-1stab PAI-1stab(E28 5A) 74 91 80 59 74 51 90 57 88 18 52 63 32 88 77 75 87 10 13 33 97 82 ... indistinguishable results: wild-type, PAI -1( T9 6A) , PAI1(F10 0A) , PAI -1( V12 6A) , PAI -1( F12 8A) , PAI -1( I13 7A) , PAI -1( I13 8A) , PAI -1( N13 9A) , PAI -1( W14 1A) , PAI1(T14 6A) and PAI -1( M149K) Structural analysis...

Ngày tải lên: 20/02/2014, 11:20

Ngày tải lên: 18/03/2014, 20:20

... identifiable and unidentifiable models Biometrika, 61: 2: 2 15 2 31 V Hatzivassiloglou and K McKeown 19 97 Predicting the semantic orientation of adjectives In ACL-EACL 19 97, pages 17 4 -18 1, Madrid, Spain, ... transformation-based learning In Proc COLING-ACL 19 98, pages 11 50 -11 56 , Montreal, Canada, August T .A van Dijk 19 88 News as Discourse Lawrence Erlbaum, Hillsdale, NJ J Wiebe, R Bruce, and L Duan 19 97 Probabilistic ... held-out portion of the training data 10 -fold cross validation is performed The data is partitioned randomly into 10 different SFor the analysis in Table 3, certainty ratings and 1, and and are combined...

Ngày tải lên: 23/03/2014, 19:20

Ngày tải lên: 09/05/2014, 17:04

... 1. 13 ± 1. 14† 1. 11 ± 0.83† 9 .57 ± 15 .18 ‡ 1. 94 ± 5. 56 2.68 ± 0.78 5. 64 ± 11 .50 SM 1. 93 ± 1. 19† 2.39 ± 1. 69† 3.23 ± 2.37‡ 1. 17 ± 0.08† 1. 31 ± 0.24† 4 .53 ± 1. 09‡ SS 1. 37 ± 0.87‡ 1. 94 ± 0.99‡ 2. 85 ... conclusions and broaden the scope of application http://www.jneuroengrehab.com/content/6 /1/ 15 10 11 12 13 14 15 16 17 Competing interests The authors declare that they have no competing interests 18 Authors' ... (DPTT) and The means and standard deviation of the performance metrics in eight-point rectangle target acquisition task across subjects Figure The means and standard deviation of the performance...

Ngày tải lên: 19/06/2014, 08:20

... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT 64 TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG ... TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG ||||||||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| 15 44 TGGACCCGTTTCATGGAAGACAGCTTCCCTATCGTGAACGACCAAGAAATTATGGACGTG 63 15 43 12 3 16 03 12 4 TTTCTAGTGGTGAACATGCGTCCCACTAGACCGAACCGTTGCTTT-AGATTTTTGGCGCA ... -GTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAGAAAGGTGGCGGCT || |||||| || | |||||| |||||||||||||| || |||||||| || ||||||| 17 23 CGT-GTACGTAGGAAACAACAACGAATACCGCATCAGCCTGGCCAAGAAGGGCGGCGGCT 3 01 302 GTCCC-GTGATGAACCTGCACGCCGAATACAC-CACTTCGTTTGA-GAGTTTCATCGACA...

Ngày tải lên: 20/06/2014, 01:20

... modes available and realize as fast as possible if the classified standards are unavailable inside itself and also realize the libraries and software module downloads needed from the network 25 mW ... and discussed As a case study, two standards are considered: WLAN 802 .11 b [16 ] and Bluetooth [17 ] The choice of these two standards stems from three factors: first, they are based on DS-CDMA and ... deterministic signals,” Proceedings of IEEE, vol 55 , no 4, pp 52 3 5 31, 19 67 [12 ] C Roland and J Palicot, A self-adaptive universal receiver,” Annales des T´l´communications, vol 57 , no 5- 6, pp 4 21 456 , ee...

Ngày tải lên: 23/06/2014, 01:20

... by Brassicaceae and Asteraceae (3 species each), then Lamiaceae, Plantaginaceae, Boletaceae, Agaricaceae, Russulaceae and Ramariaceae (2 species each) For 15 families only one species was listed ... 27 10 14 Bellis perennis 27 6 ,5 15 Juglans regia 20 16 Rumex sp 13 4 ,5 17 Plantago lanceolata 13 2 ,5 18 Amanita rubescens 13 11 19 Allium ursinum 13 10 20 Prunus avium subsp avium 13 12 ,5 21 Glechoma ... widespread uses of gathered greens are for Taraxacum sp leaves as a salad, often mixed with Page 12 of 14 potatoes (Solanum tuberosum) (Röhrlsalat), and the preparation of Urtica dioica as a spinach...

Ngày tải lên: 10/08/2014, 09:21

... dural space i.e brainstem, basilar Figure Sagittal and axial views of brain MRI scan Sagittal and axial views of brain MRI scan Image shows tumour in the nasopharynx extending from nasal cavity ... Momose KJ, Carroll R, et al.: The role of MR and CT in evaluating clival chordomas and chondrosarcomas Am J Roentgenol 19 88, 15 1(3) :56 7 -57 5 Hellquist HB: Pathology of the Nose and Paranasal Sinus ... from skull base to first cervical vertebra, was not adequate with this approach alone, a paramedian mandibulotomy facilitating a left mandibullar swing was also performed However a massive tongue...

Ngày tải lên: 11/08/2014, 10:23

... http://www.jmedicalcasereports.com/content/4 /1/ 204 10 11 12 13 14 15 16 17 18 19 Martinez-Taboada VM, Blanco R, Garcia-Fuentes M, Rodriguez-Valverde V: Clinical features and outcome of 95 patients with hypersensitivity vasculitis Am ... laboratory, and multispecialty collaboration, no alternative diagnosis applied to our patient We reiterate that amputation in this scenario was an unfortunate and Page of debilitating last resort ... J Med 19 97, 10 2 :18 6 -19 1 Taylor HG, Samanta A: Treatment of Vasculitis Brit J Clin Pharmacol 19 93, 35: 93 -10 4 Tosca N, Stratigos JD: Possible pathogenetic mechanisms in allergic cutaneous vasculitis...

Ngày tải lên: 11/08/2014, 11:20

... et al Health and Quality of Life Outcomes 2 010 , 8: 75 http://www.hqlo.com/content/8 /1/ 75 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Page of Rosenfeld RM, Goldsmith AJ, Tetlus L, Balzano A: Quality ... represent a problem of increasing intensity and a severity score was calculated as the mean of the scores in the six domains The OM-6 also contains a visual analog scale of happy and sad faces allowing ... ( 41) 56 ( 35) 25 (16 ) 14 (9) (0) 1. 9 (0.9) Caregiver emotional distress 55 (34) 57 ( 35) 31 (19 ) 18 (11 ) (0) 2 .1 (1. 0) Caregiver concerns Severity score (mean) 24 ( 15 ) 40 ( 25) 71 (44) 26 (16 ) (0)...

Ngày tải lên: 12/08/2014, 01:21

... and adjusted Cy5 intensities as technical replicates and calculated the mean of these values The ratio of this mean on the average of the intensity across the array set was then obtained A ratio ... National Institutes of Health (NIAID/NIH) to Fatah Kashanchi Fatah Kashanchi and Steve Jacobson share senior authorship 18 19 20 21 References Hegde P, Qi R, Abernathy K, Gay C, Dharap S, Gaspard ... Genomic organization of arrayed viruses Locations and direction of transcription of each open reading frame of the arrayed viral genomes are shown Red arrows indicate ORFs that were amplified and spotted...

Ngày tải lên: 13/08/2014, 13:20

... (22 .5% ) 31 (18 %) (9%) 18 (10 .5% ) 0.82 (7 .5% ) 11 (6 .5% ) 0.79 Renal failure, Metabolic acidosis (6%) 11 (6 .5% ) 1. 0 Acute Pulmonary Odema (6%) 12 (7%) 1. 0 11 (14 %) 23 (13 .5% ) 1. 0 61. 6 ± 18 .3 60 .5 ... least 0. 05 unit PRBC/patient/day with a standard deviation of 0 . 15 units PRBC/patient/day Statistical analysis We expressed variables as means ± standard deviations and numbers (percentages), and ... trial Crit Care Med 19 96, 24 :11 57 -11 62 O'Hare D, Chilvers RJ: Arterial blood sampling practices in intensive care units in England and Wales Anaesthesia 20 01, 56 :56 8 -5 71 Criticalan open access articlehttp://ccforum.com/content /14 /1/ R7...

Ngày tải lên: 13/08/2014, 20:21

... potentials at regional scale in Brazil Graef and Stahr (2000) used the SOTER approach for management of soil, terrain, and land use and vegetation data at regional scale Herrmann et al (20 01) applied ... 5. 2 .10 .5 Biological activity 15 5 5.2 .10 .6 Human impact 15 5 5.2 .10 .7 Time 15 6 5. 3 Validation of the soil and soil quality maps 15 8 5. 3 .1 Validation of the ... reticulata, E inaequicostata, Claraia aurita, C stachei Thickness 310 m 12 T1 Viên Nam Formation: aphyric basalt, magnesium-high basalt, andesitobasalt, andesitodacite, trachyte, porphyritic trachyte,...

Ngày tải lên: 11/09/2015, 15:45

... 2 45 Figure G10 Variation of specific heat transfer area with heat medium flow rate for corrugated tubes with variable corrugation pitch and depth G1.3 GRAPHS OF VARYING FEED TEMPERATURE Figure ... tubes with variable corrugation pitch and depth Figure G5 Variation of specific heat transfer area with heat medium temperature for corrugated tubes with variable corrugation pitch and depth ... Figure G18 Variation of specific heat transfer area with feed temperature for smooth tubes and smooth tubes with insertions G1.4 GRAPHS OF VARYING FEED FLOW RATE Figure G19 Variation of water production...

Ngày tải lên: 14/09/2015, 08:36

... 6.37 5. 4 4. 61 4. 85 5 .56 5. 54 5. 51 5. 45 8.96 9. 85 5.28 6.64 2.69 4.68 4.42 5 .17 1. 59 3.34 9 .57 7.29 5. 34 5 .18 D AAA BBBBBBBB BBB ABB+ B+ BB BBBBBBBBBBBBAAA AAA BB+ A CCC BBB+ BB+ CCCCCC+ AAA AA BB+ ... 8 . 15 7.6 7.3 18 15 6. 85 24 6. 65 42 6.4 38 6. 25 38 5. 85 59 5. 65 52 5. 25 34 4. 95 25 4. 75 65 4 .5 78 4 . 15 11 5 3. 75 95 3.2 23 2 .5 10 1. 75 14 27 An Emerging Market Credit Scoring System • Step 1- Calculate ... 6. 25 Rating AAA AA+ AA AAA+ A ABBB+ BBB Z''-Score 5. 65 5. 25 4. 95 4. 75 4 .50 4 . 15 3. 75 3.20 2 .50 1. 75 < 1. 75 Rating 5. 85 5. 65 5. 25 4. 95 4. 75 4 .50 4 . 15 3. 75 3.20 2 .50 1. 75 BBBBB+ BB BBB+ B BCCC+...

Ngày tải lên: 04/10/2015, 10:26