use of signal transducer and activator of transcription 3 as a risk factor for poor
Báo cáo y học: "Analysis and evaluation of environmental tobacco smoke exposure as a risk factor for chronic cough" docx
... symptom of cough has not been analysed in great detail so far Therefore, the present study aimed to analyse the association of ETS and cough on the basis of database searches and existing clinical and ... Furusho S, Kita T, Katayama N, Abo M, Ohkura N, Herai Y, Hori A, Ishiura Y, Nobata K, Ogawa H, Yasui M, Kasahara K, Nakao S: Comparison of cough reflex sensitivity after an inhaled antigen challenge ... only lead to lung cancer and cardiorespiratory disease but is also related to numerous respiratory symptoms Whereas it has been known for a long time that exacerbations of bronchial asthma and chronic...
- 6
- 304
- 0
Báo cáo y học: "A multicentre case-control study of nonsteroidal anti-inflammatory drugs as a risk factor for severe sepsis and septic shock" docx
... investigator All NSAIDs and aspirin were considered However, when aspirin was taken as an antiplatelet aggregant for the prevention of cardiovascular diseases (
- 7
- 467
- 0
Báo cáo y học: " Is distortion of the bioprosthesis ring a risk factor for early calcificatio" docx
... this article as: Cereijo et al.: Is distortion of the bioprosthesis ring a risk factor for early calcification? Journal of Cardiothoracic Surgery 2010 5:77 Author details Department of Cardiovascular ... Cardiovascular Surgery, Santiago de Compostela University Hospital La Choupana, Santiago de Compostela 15706, Spain 2Department of Radiology, Santiago de Compostela University Hospital La Choupana, Santiago ... Santiago de Compostela 15706, Spain 3Department of Pathology, Santiago de Compostela University Hospital La Choupana, Santiago de Compostela 15706, Spain Authors’ contributions JMMC drafted the manuscript...
- 3
- 370
- 0
báo cáo khoa học: " Intestinal adhesion due to previous uterine surgery as a risk factor for delayed diagnosis of uterine rupture: a case report" pot
... References Gupta A, Nanda S: Uterine rupture in pregnancy: a five-year study Arch Gynecol Obstet 2011, 2 83( 3): 437 -441 Morimatsu Y, Matsubara S, Higashiyama N, Kuwata T, Ohkuchi A, Izumi A, Shibhara H, ... cesarean: a case series and review of the literature Am J Perinatol 2009, 26(10): 739 -744 Kurdoglu M, Kolusari A, Yildizhan R, Adali E, Sahin HG: Delayed diagnosis of an atypical rupture of an ... Kuwata et al Journal of Medical Case Reports 2011, 5:5 23 http://www.jmedicalcasereports.com/content/5/1/5 23 made Slight abdominal pain continued with stable vital signs and unremarkable laboratory...
- 3
- 328
- 0
Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf
... Antisense GGAGGTGGAGCAATTAGCCG GGGTTATGTTAGCTCAGTTACAGTA CTTTCCCCAAGTGCTCCTCCTA GGGTTATGTTAGCTCAGTTACAGTA TGGACGCGCGTAACCCGCAC GGGTTATGTTAGCTCAGTTACAGTA GCGCTGAAGCGCAGGCGGTCA GGGTTATGTTAGCTCAGTTACAGTA ... 5¢-TCT ATC TCT CGA TGG ATA CAG A -3 ; reverse, 5¢-AGG ACA GTA GAA TTA GGT CAC T -3 ) Knockdown of Hsp10 5a and Hsp105b The double-stranded RNA targeting Hsp105 (Dharmacon; 5¢-GCA AAU CAC UCA UGC AAA ... Stephanou A, Isenberg DA, Akira S, Kishimoto T & Latchman DS (1998) The nuclear factor interleukin-6 (NF-IL6) and signal transducer and activator of transcription- 3 (STAT -3) signalling pathways...
- 11
- 584
- 0
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf
... signal transducer and activator of transcription recruitment sites within the epidermal growth factor receptor Cancer Res 63, 39 23 39 30 Fujitani Y, Nakajima K, Kojima H, Nakae K, Takeda T & Hirano ... Constitutive activation of Stat3 by the Src and JAK tyrosine kinases participates in growth regulation of human breast carcinoma cells Oncogene 20, 2499–25 13 Kanda N, Seno H, Konda Y, Marusawa H, Kanai ... pathway can cause expression of caspase and apoptosis Mol Cell Biol 17, 532 8– 533 7 Lin Q, Lai R, Chirieac LR, Li C, Thomazy VA, Grammatikakis I, Rassidakis GZ, Zhang W, Fujio Y, Kunisada K et al...
- 11
- 558
- 0
Báo cáo khoa học: A novel splicing variant form suppresses the activity of full-length signal transducer and activator of transcription 5A pot
... STAT1, STAT3, STAT4, STAT 5A and STAT5B mRNAs are alternatively spliced at the 3 -end, resulting in the production of b-isoforms truncated at the transactivation domain STAT 5A b-isoforms and STAT5B ... Lane 12: STAT 5A_ FL cDNA Lane 13: STAT 5A_ DE18 cDNA variant of STAT 5A, and also lacked the transactivation domain and tyrosine residue (Fig 2B) Immunoblotting and immunocytochemical analyses of ... generate a 439 bp fragment for STAT 5A_ FL and a 38 7 bp fragment for STAT 5A_ DE18 (upper panel) RT-PCR amplification of glyceraldehyde -3- phosphate dehydrogenase (G3PDH) is indicated as an internal...
- 12
- 484
- 0
Báo cáo khoa học: Synergistic co-operation of signal transducer and activator of transcription 5B with activator protein 1 in angiotensin II-induced angiotensinogen gene activation in vascular smooth muscle cells potx
... demonstrated that the activation of STAT5B in the liver, and of STAT3 and STAT 5A in the heart, participates in transcription activation of the AGT gene to modulate the autocrine Ang II loop, and that ... Y, Mascareno E & Siddiqui MA (2004) Distinct components of Janus kinase ⁄ signal transducer and activator of transcription signaling pathway mediate the regulation of systemic and tissue localized ... [10], and Ang II activates JAK-STAT and AP-1 [ 23] To determine the relationship between the activation of STAT5B and c-Jun, and STAT5B and AP-1 interaction in AGT gene activation the expression of...
- 9
- 331
- 0
Báo cáo y học: "Attenuation of murine antigen-induced arthritis by treatment with a decoy oligodeoxynucleotide inhibiting signal transducer and activator of transcription-1 (STAT-1)" ppt
... gta aa -3' and 5'-gca cac atg gag gtc aaa tg -3' (PCR product size 68 bp); IRF-1, 5'-gca aaa cca aga gga agc tg -3' and 5'-cag gta gcc ctg agt ggt gt -3' (PCR product size 1 13 bp); GAPDH, 5'-gac cac ... 5'-gac cac agt cca tgc cat cac tgc -3' and 5'-atg acc ttg ccc aca gcc ttg g -3' (PCR product size 137 bp); β-actin, 5'-cca cag ctg aga ggg aaa tc -3' and 5'-tct cca ggg agg aag agg at -3' (PCR product ... hands, expression of IRF-1 at mRNA level was also significantly elevated at day and of the acute phase of AIA These data imply that activation of the STAT-1 pathway plays an important role in our...
- 13
- 449
- 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry
... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31 ], α-glucuronidases that release ... Biochemistry 2005, 36 93- 3700 [67] Saha B.C., Atanu B., Cotta M .A Microwave pretreatment, enzymatic saccharification and fermentation of wheat straw to ethanol Journal of Biobased Materials and Bioenergy ... acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital...
- 20
- 437
- 0
Báo cáo y học: " Use of cracked maize as a carrier for NDV4 vaccine in experimental vaccination of chickens" pot
... which was soaked in water for Page of three days, with a daily change of water (1 :3; w/v) After the third day, it was sun-dried on a clean and well washed surface this was for the birds in cage ... Journal et al; from: distributed under the article is available article References Alexander DJ: Newcastle disease, An Avian Paramyxovirus In Newcastle disease Edited by: Alexander DJ Kluwer Acad ... 71 :32 5 -33 9 Allan WH, Gough RE: A standardised Haemagglutination test for Newcastle disease Comparison of Macro and Micro methods Vet Rec 1974, 95:120-1 23 Darminto , Daniels PW: Laboratory trials of...
- 5
- 285
- 0
Báo cáo y học: "Early postoperative hyperglycaemia is not a risk factor for infectious complications and prolonged in-hospital stay in patients undergoing oesophagectomy: a retrospective analysis of a prospective trial" ppsx
... complications, and linear regression analysis was used for length of stay Because of nonparametric distribution, length of stay data were logarithmically transformed before regression analysis Parameters ... undergone cardiovascular bypass surgery and peripheral vascular surgery [12-16] Few patients in our cohort suffered from (cardio)vascular disease because ASA class or was a prerequisite for inclusion ... undergoing transhiatal or transthoracic esophagectomy for cancer Ann Surg 20 03, 237 :35 - 43 Katz MH: Multivariable analysis: a primer for readers of medical research Ann Intern Med 20 03, 138 :644-650 Van...
- 6
- 368
- 0
Báo cáo y học: "Dynamic cumulative activity of transcription factors as a mechanism of quantitative gene regulation" docx
... Detailedpulsenumbertimetwo-regulatorthetime-seriesSpellman with Additionalandperturbationthe figurestheall thein thedata database 17 O 2and data the 1, time forfor and all time-shift asandstress data points, results ... pointsfileamong modesand three-regulator the Cho data in datacomparisonof all as fordatafrom inmotifs and motifs data and anddistribution file51 of annotated by from Clickwithresults ofdistribution ... Hebert JM, Hernandez-Boussard T, Jin H, Matese JC, Nitzberg M, Wymore F, et al.: The Stanford Microarray Database accommodates additional microarray platforms and data formats Nucleic Acids Res 2005:D580-582...
- 18
- 273
- 0
Development of bordetella pertussis as a live vehicles for heterologous antigens delivery, and its application as a universal influenza a vaccine
... particular, the universal influenza vaccine candidate M2e was expressed in BPZE1 as a FHA-(M2e )3 chimera and the nasal administration of the recombinant BPLR3 bacteria triggered significant production ... and the Middle East, as well as the occasional infections of humans with an overall fatality rate of over 60%, have caused worldwide concern about a potential new global epidemic of influenza ... of mucosal routes have been considered for vaccination purposes, including the oral, nasal, rectal and vaginal routes By far oral and intranasal vaccinations have been the most commonly and extensively...
- 258
- 303
- 0
Use of lactococcus lactis as a mucosal vaccine delivery vehicle
... 38 3. 3 Viral quantitation using plaque assay 3. 3.1 Cell viability assay 39 3. 3.2 Plaque assay 39 3. 4 Plaque reduction neutralization test (PRNT) 40 3. 5 Bacterial strains and cultures 3. 5.1 Bacterial ... injuries and elevated alanine aminotransferase and aspartate aminotransferase These observations mimic the liver alterations in dengue infected humans (Paes et al., 2005) Atrasheukay and co-workers ... University of Basel and NUS, For making this Joint Masters possible and making it such a wonderful experience Kelly, For her constant help in viral and plaque assays aspects of my work And also for all...
- 113
- 160
- 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
... was stored at ) 80 °C for analysis for metals Paraffin sections lm thick were prepared and stained with hematoxylin and eosin The gonadal maturity of each animal was classified into five stages according ... phosphate as a substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The ... measured by the Bradford method [51] using a Bio-Rad protein assay (Bio-Rad, Hercules, CA, USA) with bovine c-globulin as a standard Thyroglobulin (669 kDa), catalase ( 232 kDa), BSA (67 kDa) and...
- 14
- 442
- 0
Báo cáo lâm nghiệp: "Frost damage on the terminal shoot as a risk factor of fork incidence on common beech (Fagus sylvatica L.)" docx
... confirmed that “damage” was an explanatory factor which was much significant than the other variables and factors available Thus overall, the damage factor had both a statistical and a causal value, ... emergence was calculated for each of the damage levels The relative risk of fork emergence, with its confidence limit (at 5% of risk level), was calculated for each of the damage levels, “red spots” and ... test and the part of variability it explains was quantified by the two forms of generalised coefficients of determination Rsquare and Max-rescaled Rsquare (proposed by Cox and Snell, and Nagelkerke...
- 8
- 348
- 0
báo cáo khoa học: " A case report: Pavlovian conditioning as a risk factor of heroin ''''overdose'''' death" pot
... there is a need for educational programmes as part of the treatment, making users receiving treatment aware of the nature and risks of conditioning The more users are aware of the role played by ... Heroin concentration levels in a case A after conditioning in an accustomed place (A1 ) and in a new place (A2 ), and in a case B without conditioning have the opportunity for secondary conditioning ... http://www.harmreductionjournal.com/content/2/1/11 Figure withoutconcentration levels in a case A after conditioning in an accustomed place (A1 ) and in a new place (A2 ), and in a case B Heroin...
- 4
- 369
- 0
Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx
... refinement of risk of osteoarthritis and low back pain based solely on BMI Limitations of obesity as a risk factor for low back pain A significant difficulty in ascertaining cause and effect ... basic research appeared to conclude what was already intuitively thought about low back pain and increased weight Body mass index Before an in-depth discussion of low back pain and obesity can ... Library of Medicine, was used to ascertain pertinent articles between the years 1990 and 2004 The use of keywords "obesity", "body mass index", "BMI" and "low back pain" was used to obtain relevant...
- 6
- 402
- 0
Work environment as a motivating factor for self improvement of english A case study of projects in cảe internatinal in viet Nam
... consent for participation in the research The second and more important reason was that sending the questionnaire via email was fast, cheap and easy to reach the target groups and get feed back from ... gave the excuse for that as “because I have accomplished my tasks as required”, “because now my English in use is good enough” and also because “I have small children to take care of so I cannot ... a specific case of projects in CARE International in Vietnam Another reason is that the author has been a part of the “natural setting” She has been working in CARE International in Vietnam for...
- 11
- 442
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25