Báo cáo khoa học: Synergistic co-operation of signal transducer and activator of transcription 5B with activator protein 1 in angiotensin II-induced angiotensinogen gene activation in vascular smooth muscle cells potx

Synergistic co-operation of signal transducer and activator of transcription 5B with activator protein 1 in angiotensin II-induced angiotensinogen gene activation in vascular smooth muscle cells Mei Han, Ai-Ying Li, Fang Meng, Li-Hua Dong, Bin Zheng, Hai-Juan Hu, Lei Nie and Jin-Kun Wen Department of Biochemistry and Molecular Biology, Hebei Medical University, Shijiazhuang, China Angiotensin II (Ang II), an extensively characterized peptide produced by successive proteolytic cleavage reactions of its prohormone, angiotensinogen (AGT), is an important contributor to the regulation of vol- ume homeostasis and blood pressure in humans and to the initiation of pathophysiological events that lead to hypertension and cardiovascular disorders [1,2]. In human genetic studies, a clear linkage has been established between the AGT gene and hypertension [3]. Several lines of evidence have indicated that small variations in AGT concentration result in substantial changes in the circulating Ang II levels [4]. At the cellular level, Ang II-mediated signaling is achieved through its binding to the cell-surface AT1 receptor, which causes activation of Janus kinase 2 (JAK2) [5,6] and then activates signal transducer and activator of transcription (STAT) molecules in cardiac myocytes and in rat aortic (vascular) smooth muscle cells (VSMCs) [5,7–9], resulting in the positive feedback of AGT transcription [5]. The AGT gene itself is the target for the activated STAT protein in cardiac myo- cytes through the AGT promoter region [5]. However, the interaction of STAT5B with the AGT gene promoter was observed in liver and cardiac myocytes [8,10], but not in the smooth muscle cell line. The molecular basis for activation of the AGT gene is only partially understood. The analysis of biological information presumes that the 500-bp region of the rat Keywords activator protein-1; angiotensinogen; gene regulation; signal transducer and activator of transcription-5; vascular smooth muscle cells Correspondence J K. Wen, Department of Biochemistry and Molecular Biology, No. 361, Zhongshan East Road, Shijiazhuang 050017, China Fax: +86 311 8626 6180 Tel: +86 311 8626 5563 E-mail: wjk@hebmu.edu.cn (Received 29 October 2008, revised 29 December 2008, accepted 12 January 2009) doi:10.1111/j.1742-4658.2009.06902.x The binding sequences for signal transducer and activator of transcription (STAT) and activator protein 1 have been found in the promoter region of the angiotensinogen gene. We examined whether the elements for activator protein 1 and STAT5B function in angiotensinogen gene activation induced by angiotensin II in vascular smooth muscle cells. Stimulation with angio- tensin II increased the level of angiotensinogen mRNA by 2.1-fold in vascular smooth muscle cells. The increased level of angiotensinogen mRNA occurred with concurrent elevations in the levels of STAT5B and c-Jun phosphorylation after stimulation with angiotensin II. Likewise, angiotensin II resulted in similar enhancements of the DNA-binding activ- ity of STAT5B and c-Jun in angiotensin II-induced angiotensinogen expres- sion. Notably, the STAT5B–DNA complex interacted with the c-Jun–DNA complex by forming a stable quaternary complex in angiotensin II-induced angiotensinogen expression. Our findings support a model in which co-operative interaction of STAT5B and activator protein 1 bound to the the promoter region provides maximal activation of angiotensinogen expression by angiotensin II in vascular smooth muscle cells. Abbreviations AGT, angiotensinogen; Ang II, angiotensin II; AP-1, activator protein 1; ChIP, chromatin immunoprecipitation; CoIP, cross- coimmunoprecipitation; EMSA, electrophoretic mobility shift assay; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; JAK, Janus kinase; STAT, signal transducer and activator of transcription; VSMCs, vascular smooth muscle cells. 1720 FEBS Journal 276 (2009) 1720–1728 ª 2009 The Authors Journal compilation ª 2009 FEBS AGT gene promoter contains clusters of regulatory elements, perfectly or partially matched to consensus sequences, including binding sequences for STAT5B and activator protein 1 (AP-1). Previous studies indi- cate that transcription activation by STATs requires activated AP-1 [11–13]. AP-1 is a complex composed of the Fos and Jun proteins [14–16]. In general, Fos and Jun family proteins function as dimeric transcrip- tion factors that bind to AP-1 regulatory elements in the promoter and enhancer regions of the target [14,16]. However, the role of AP-1 in AGT gene tran- scription activation is unknown. It has been demon- strated that STAT proteins co-operate to bind to target DNA, not only with other STAT family mem- bers [17–19], but also with other proteins and tran- scription factors [11,13,20,21]. Recently, the physical association between STAT and c-Jun on the a 2 -macro- globulin promoter element has been shown to yield maximal enhancer function [13]. Based on these pieces of knowledge, we hypothe- sized that co-operative interaction between c-Jun and STAT5B may be important in transcription activation of the AGT gene induced by Ang II. To understand whether elements for AP-1 and STAT5B function in AGT gene activation induced by Ang II, we tested the effect of co-operative interaction between c-Jun and STAT5B on the AGT promoter activity and AGT mRNA expression in VSMCs. We showed that Ang II-induced AGT expression in VSMCs involves co-operation between AP-1 and STAT5B. We also demonstrated that there exists a physical interaction between AP-1 and STAT5B during AGT expression induced by Ang II. Results Ang II increases AGT gene expression with concurrent increases in the phosphorylation of STAT5B and c-Jun in VSMCs It has been demonstrated that Ang II stimulates AGT expression in hepatocytes [22] and in cardiac muscle [5]. The present study showed that Ang II increased the AGT mRNA level in VSMCs. Follow- ing treatment of VSMCs with Ang II for different periods of time, AGT mRNA was detected using RT-PCR. As shown in Fig. 1A, the level of AGT mRNA peaked 3 h after stimulation with Ang II, showing an increase of 5.2-fold, and decreased there- after. STAT5B is necessary for expression of the AGT gene [10], and Ang II activates JAK-STAT and AP-1 [23]. To determine the relationship between the activation of STAT5B and c-Jun, and the expression of the AGT gene in VSMCs stimu- lated with Ang II, the effect of Ang II on the phos- phorylation of STAT5 and c-Jun was measured. Ang II stimulated the phosphorylation of STAT5B and c-Jun, with levels of phosphorylated STAT5B and c-Jun significantly increasing 1 h, and peaking 3 h, after stimulation with Ang II, whereas total c-Jun and STAT5B were not changed after treatment with Ang II for different periods of time (Fig. 1B). However, the phosphorylation of STAT5B induced by Ang II was dramatically inhibited by pretreating VSMCs with AG490 (a specific inhibitor of the JAK-STAT pathway) for 16 h [24], indicating that the activation of STAT5B and c-Jun may be involved in Ang II-induced AGT mRNA expression (Fig. 1C). DNA-binding activity of STAT5B and c-Jun increases in Ang II-induced AGT expression To find out whether the increase in STAT5B and c-Jun phosphorylation induced by Ang II affects the binding of STAT5B and c-Jun to their cis-elements, the activity of STAT5B binding and of c-Jun binding to DNA was detected, respectively, by electrophoretic mobility shift assays (EMSAs) using radiolabeled oli- gonucleotides containing either a STAT5B-binding site or an AP-1-binding site in the rat AGT gene promoter. As shown in Fig. 2A,B, DNA–protein complexes were formed when these two probes were incubated with nuclear extracts from VSMCs treated with Ang II for 0.5, 1, and 3 h, and the DNA-binding activity of STAT5B and of AP-1 increased in a time-dependent manner. The specificities of two DNA–protein com- plexes were demonstrated by their disappearance upon the addition of a 100-fold molar excess of unlabeled probe. Further to confirm whether STAT5B and AP-1 are involved in the shifted complexes, supershift assays were performed by adding antibodies against STAT5B or c-Jun. Figure 2A,B showed new supershifted bands, indicating that the complexes contained STAT5B or c-Jun. Finally, to verify whether Ang II can stimulate recruitment of STAT5B and c-Jun to the AGT pro- moter in vivo, chromatin immunoprecipitation (ChIP) assays were performed using antibodies to STAT5B and to c-Jun, respectively. As shown in Fig. 2C, DNA fragments containing the STAT5B- and AP-1-binding sites could be detected in the immunoprecipitates pulled by anti-c-Jun or anti-STAT5B IgGs. Increased binding of AP-1 or STAT5B to the AGT promoter was observed in VSMCs treated with Ang II for 3 h. However, AG490 decreased the recruitment of STAT5B to the AGT promoter region with the M. Han et al. STAT5B and AP-1 interaction in AGT gene activation FEBS Journal 276 (2009) 1720–1728 ª 2009 The Authors Journal compilation ª 2009 FEBS 1721 inhibition of STAT5B phosphorylation (Fig. 1C and Fig. 2C), suggesting that STAT5B phosphorylation is necessary for its binding to the AGT promoter. Co-operation of STAT5B with AP-1 activates the AGT promoter To determine whether the binding of STAT5B and AP-1 with the AGT promoter is essential to AGT expression induced by Ang II, 293A cells were cotrans- fected with the pGL3-AGT-Luc reporter plasmid, which contains both AP-1- and STAT5B-binding sequences in the AGT promoter from )545 to 39 bp (Fig. 3A), and pcDNA3.1-STAT5B and ⁄ or pcDNA3.1-c-Jun expres- sion plasmids. Overexpression of STAT5B or c-Jun alone modestly increased the reporter activity following stimulation with Ang II (Fig. 3B). On the other hand, the cotransfection of STAT5B with c-Jun expression vectors significantly increased the AGT reporter activity by 6.8-fold over that seen with the reporter alone. These results indicate that STAT5B and c-Jun synergistically activate AGT gene transcription. STAT5B and AP-1 form a stable complex in the AGT promoter in Ang II-induced AGT expression To establish whether there is a direct interaction between STAT5B and c-Jun in the expression of AGT induced by Ang II stimulation, DNA–protein inter- actions were investigated by cross-supershift assays. As seen in EMSAs, DNA–protein complexes formed by 0 2 4 6 8 10 0 h 1 h 3 h 6 h Relative level p-c-Jun pSTAT5B Ang II 0136 h IP: c-Jun/ IB: p-Ser IP:c-Jun/ IB: c-Jun IP:STAT5B/IB: PY99 * * * * * * Ang II A B C 03 61224 h AGT GAPDH * * * * Relative mRNA level 0 2 4 6 8 0 h 3 h 6 h 12 h 24 h IP: STAT5B/IB: PY99 IP:STAT5B/IB: STAT5B Ang II – 3366 h AG490 –– + +– – 3366 h ––+ +– * 0 2 4 6 8 10 Relative pSTAT5B level Ang II AG490 * IP:STAT5B/IB: STAT5B Fig. 1. Ang II induces AGT gene expression with concurrent increases in the phosphorylation of c-Jun and STAT5B in VSMCs. (A) VSMCs were treated with Ang II (10 )7 M) for 0, 3, 6, 12 and 24 h. Total RNA was isolated from VSMCs and subjected to RT-PCR analysis using specific primers of the AGT gene. GAPDH was used as an internal control. Bar graphs show the relative level of AGT mRNA for four independent experiments. *P < 0.05, com- pared with 0 h (n = 3). (B) VSMCs were treated with Ang II (10 )7 M) for the indicated periods of time. Cell extracts were immunoprecipitated with antibodies to c-Jun or to STAT5B and immunoblotted with anti-phospho-Ser IgG or anti-PY99 IgG by western blot analysis. Bar graphs show the relative level of phos- phorylated c-Jun or phosphorylated STAT5B for four independent experiments. *P < 0.05, compared with 0 h (n = 3). (C) VSMCs were pretreated with or without AG490 (10 )5 M) for 16 h before stimulation with Ang II (10 )7 M) for 3 and 6 h. Cell extracts were immunoprecipitated with anti-STAT5B IgG and analyzed by western blotting using anti-PY99 and anti-STAT5B IgGs, respectively. Bar graphs show the relative level of phosphorylated STAT5B for four independent experiments. *P < 0.05, compared with treatment without AG490 in Ang II-treated cells for 3 and 6 h, respectively (n = 3). STAT5B and AP-1 interaction in AGT gene activation M. Han et al. 1722 FEBS Journal 276 (2009) 1720–1728 ª 2009 The Authors Journal compilation ª 2009 FEBS A Ang II Nuclear extract STAT5B probe Cold STAT5B probe Anti-STAT5B IgG Anti-c-Jun IgG Rabbit IgG – – 0.5 1 3 3 – 33 3 3 3 h –+++++ –+++++ ++++++ ++++++ –––––+ –+–––– –––––– –––––+ –––––– ––––+– –––––– –––+–– Supershift Shift Free probe Ang II Nuclear extracts AP-1 probe Cold AP-1 probe Anti-c-Jun IgG Anti-STAT5B IgG Rabbit IgG – – 0.5 1 3 3 3 – 33 3 h –++++++–+++ +++++++++++ ––––– + ++ –– –– ––––––––– +– ––––––––– –+ ––––––– –+– – Supershift Shift Free probe B C Ang II AG490 –3 3 h –– + IP: STAT5B No antibody Input Ang II 0 0.5 1 3 6 12 h IP: c-Jun No antibody Input STAT5B binding sequence AP-1 binding sequence Fig. 2. Ang II increases the DNA-binding activity of AP-1 and STAT5B. (A and B) VSMCs were treated with Ang II (10 )7 M) for 0.5, 1 and 3 h. Nuclear extracts were analyzed by EMSA using oligonucleotide probes containing the AP-1-binding site (A) and the STAT5B-binding site (B) in the AGT gene promoter. Protein–DNA complexes were separated by nondenaturing PAGE and then visualized by autoradiography. Super- shift assays were performed by adding anti- bodies against c-Jun or STAT5B. Rabbit IgG was used as negative control. The data shown represent the best of three indepen- dent experiments. (C) VSMCs pretreated with or without AG490 were treated with Ang II (10 )7 M) for the indicated periods of time. Chromatin fragments were immuno- precipitated by anti-c-Jun and anti-STAT5B IgG and the AGT promoter region containing the AP-1 ()644 to )381 bp) or the STAT5B ()200 to )60 bp) binding sequence was amplified by PCR, respectively. The data shown represent the best of three indepen- dent experiments. M. Han et al. STAT5B and AP-1 interaction in AGT gene activation FEBS Journal 276 (2009) 1720–1728 ª 2009 The Authors Journal compilation ª 2009 FEBS 1723 nuclear protein with the AP-1 probe were supershifted by antibody to STAT5B. Similarly, the STAT5B probe– protein complexes were supershifted by antibody to c-Jun (Fig. 2A,B). These findings indicate that AP-1 interacts with STAT5B in the AGT expression stimu- lated by Ang II. The interaction between STAT5B and AP-1 was also tested by cross-coimmunoprecipitation (CoIP) of the nuclear extracts. As shown in Fig. 4A c-Jun protein was detected in the pellets immunoprecipi- tated with antibody to STAT5B, suggesting that STAT5B interacts with AP-1. Treatment of VSMCs with Ang II for 1 and 3 h resulted in an increase in the interaction of STAT5B with c-Jun. The interaction of STAT5B with c-Jun induced by Ang II was significantly decreased by pretreating VSMCs with AG490, suggest- ing that STAT5B phosphorylation is required for the interaction of STAT5B with AP-1. To verify this further in vivo, ChIP was performed by using antibodies to c-Jun or to STAT5B. STAT5B protein was found in protein eluates from anti-c-Jun IgG-precipitated chromatin, whereas the eluates from anti-STAT5B IgG-precipitated chromatin contained c-Jun protein (Fig. 4B). Furthermore, ChIP assays showed that the STAT5B-binding sequence could be amplified by PCR in the immunoprecipitates formed with anti-c-Jun IgG, and the AP-1-binding sequence was similarly produced from the STAT5B–chromatin complexes immunopre- cipitated by anti-STAT5B IgG (Fig. 4C), indicating that STAT5B physically interacts with c-Jun by forming a stable complex with the AGT promoter in Ang II- induced AGT expression. Discussion In this report, we demonstrated, for the first time, that, in addition to STAT5, AP-1 is an important transcrip- tion factor which maintains the transcription of AGT mRNA in VSMCs, and that the activation of AP-1 participates in transcription activation of the AGT gene to modulate the autocrine Ang II loop in the local renin-angiotensin system. Jun and Fos family proteins usually function as dimeric transcription factors that bind to AP-1 regulatory elements in the promoter of numerous genes. Jun proteins can form stable homo- dimers or heterdimers with Fos proteins. Recent study has indicated that Ang II activates AP-1 to regulate sev- eral inflammatory genes in VSMCs [23]. We showed that Ang II could activate AP-1 through enhancement of the phosphorylation and association to DNA of Jun proteins in the induction of the AGT gene by Ang II in VSMCs. ChIP assays confirmed that Ang II increased the recruitment of AP-1 to the AGT gene promoter. Overexpression of c-Jun increased AGT-Luc reporter activity in A293 cells. These findings indicate that AP-1 activation is involved in regulatory mechanisms of Ang II-induced AGT gene expression in VSMCs. Ang II is known to activate the JAK-STAT pathway in several cells [9], STAT1, STAT2 and STAT3 in VSMCs [9,23,25,26] and STAT5 in cardiac myocytes [8], whereas the activity of STAT5 is unknown in Ang II-induced VSMCs under the same conditions [9,25,27]. However, we demonstrated that Ang II enhances the phosphorylation of STAT5B and its association with DNA, and consequently the transacti- vation transcription of the AGT gene in VSMCs. Super-EMSA and ChIP confirmed that Ang II could increase the binding activity of STAT5B to the cis- element and the recruitment of STAT5B to the promoter of the AGT gene in vitro and in vivo [28–32]. It was previously demonstrated that the activation of STAT5B in the liver, and of STAT3 and STAT5A in the heart, participates in transcription activation of the AGT gene to modulate the autocrine Ang II loop, and that Ang II-mediated activation of JAK2 triggers a pattern of tissue-specific phosphorylation of the pGL3-AGT-Luc pcDNA3.1-STAT5B pcDNA3.1-c-Jun pcDNA3.1 ++++ –+–+ ––++ +––– ** Relative luciferase activity 0 10 20 30 40 50 60 70 80 90 * A B STAT5B c-Jun AP-1AP-1 STAT5 tataaa –419~–412 –282~–277 –172~–163 TATA +1 Fig. 3. Co-operation of STAT5B with AP-1 activates the AGT pro- moter. (A) Schematic representation of the AP-1-binding site and the STAT5B-binding site in the AGT promoter region. (B) 293A cells were co-transfected with the pGL3-AGT-Luc reporter and with an expression vector for c-Jun, STAT5B or c-Jun + STAT5B, respec- tively. Cell lysates were subjected to luciferase activity assays and western blotting using anti-STAT5B and anti-c-Jun IgG, respectively. Bar graphs are expressed as the relative luciferase activity. *P < 0.05 versus pcDNA3.1-transfected cells (n = 3). STAT5B and AP-1 interaction in AGT gene activation M. Han et al. 1724 FEBS Journal 276 (2009) 1720–1728 ª 2009 The Authors Journal compilation ª 2009 FEBS STAT protein in different tissues [10]. Ang II causes activation of JAK via its interaction with the AT1 receptor and then activates STAT1, STAT2, STAT3, STAT5A, STAT5B and STAT6 in heart tissues under different experimental conditions [6,8]. In the present study, we provided evidence indicating that stimulation with Ang II results in JAK2 activation, which then triggers STAT5B phosphorylation and maintains the transcription of AGT mRNA in VSMCs. Treating VSMCs with AG490 (10 )5 m), a potent and selective inhibitor of JAK2 phosphorylation [24], inhibited STAT5B activation and interaction with DNA, and consequently caused a decrease in the transcription of AGT mRNA. There is an elevated level of AGT mRNA that correlated well with the enhanced STAT5B phosphorylation. These observations there- fore lend support to the notion that the activation of STAT5B and the expression of the AGT gene in VSMCs are causally linked. STAT5B may be an important upstream component in the Ang II feedback circuit that regulates the transcription of AGT mRNA in VSMCs. In the context that STAT5B and c-Jun are present in the binding complexes with the AGT gene pro- moter, we investigated whether there is any cross-talk between STAT5B and c-Jun in the induction of expres- sion of AGT mRNA by Ang II, using super-EMSA, ChIP, CoIP and western blot analysis. Co-operative DNA binding of proteins usually involves regions in close proximity, which functionally represent a com- posite regulatory element [13,14]. In this study, the 450 bp region encompassing the one STAT5B site and the two AP-1 sites of the AGT gene promoter may serve as composite binding elements. These closely located sites support that the c-Jun interaction with STAT5B in binding complexes on DNA elements is important for maximal gene activation. Experimental support of this is provided by the increased AGT pro- moter ⁄ luciferase reporter activity with co-transfection of c-Jun and STAT5B expression vectors. Definitive evidence of physical association between c-Jun and STAT5B is provided by the results of the CoIP and super-EMSA of nuclear extracts, and by the results of the ChIP assay of immunoprecipitated chromatin from IP: STAT5B/IB: c-Jun IP: STAT5B/IB: STAT5B Ang II AG490 –131 3 h –––+ + A Ang II 3 h IP Input STAT5B c-Jun No Ig IB: STAT5B IB: c-Jun IP: STAT5B Con Ang II B STAT5B binding sequence Input c-Jun IgG STAT5B IgG No Ig AP-1 binding sequence C Fig. 4. STAT5B and AP-1 form a stable complex with the AGT promoter in Ang II-induced AGT expression. (A) VSMCs were treated with Ang II (10 )7 M) for the indicated periods of time after pretreatment with or without AG490 (10 )5 M) for 16 h. Nuclear extracts were immuno- precipitated with anti-STAT5B IgG and analyzed by western blotting using anti-c-Jun and anti-STAT5B IgG, respectively. (B) VSMCs were treated with Ang II (10 )7 M) for 3 h. The protein eluates from chromatin precipitated with anti-c-Jun IgG or anti-STAT5B IgG were analyzed by western blot using anti-STAT5B and anti-c-Jun IgG, respectively. (C) The chromatin fragments immunoprecipitated with anti-c-Jun and anti-STAT5B IgG were used as templates to amplify the AGT promoter regions containing the AP-1 and STAT5B binding sequences, respec- tively. M. Han et al. STAT5B and AP-1 interaction in AGT gene activation FEBS Journal 276 (2009) 1720–1728 ª 2009 The Authors Journal compilation ª 2009 FEBS 1725 VSMCs using antibodies to c-Jun and STAT5B. Previ- ous studies have demonstrated that administration of Ang II stimulates the interaction between p300 and STAT5B in the liver, and with STAT3 and STAT5A in the heart, under similar conditions [10]. Taken together, these observations emphasize the differences in binding of STAT proteins to the same target sequence in response to stimulus. The previous reports and our data suggest a role of JAK2 phosphorylation in tissue-specific mobilization of STATs, as Ang II- mediated stimulation of physical interaction between STATs and c-Jun or the other transcription factors was effectively reduced by AG490 [10]. Yet, the selec- tive activation of STATs might require a tissue-specific factor(s), the identity of which is hitherto unknown. Previously, it has been shown that the cis-elements in the AGT promoter, well characterized for their func- tions in vitro, were dispensable in vivo [33]. We there- fore complemented our in vitro data with the studies on protein–protein and protein–DNA interactions and demonstrated that the requirement for the interaction of AP-1 with STATs for the AGT promoter activity is the same as in vitro transient transfection assays in 293A cells. Our study demonstrated that, in addition to STAT5B, AP-1 is also involved in the signal trans- duction triggered by Ang II, and pointed to the under- lying complexity in the regulation of the Ang II autocrine loop. We speculate that AP-1 and STAT5B bind to their elements in the AGT gene promoter, respectively, and meanwhile interact with each other in Ang II-stimulated VSMCs. Taken together, the inter- action of STAT5B and c-Jun bound to the promoter provides maximal activation of AGT expression by Ang II in VSMCs. Experimental procedures Cell culture Rat VSMCs were isolated and subcultured as described previously [34]. Cells used in the experiments were from passages 3–5. VSMCs were allowed to attach to the plate wall and were then serum-deprived for 24 h in DMEM (Gibco, Grand Island, NY, USA) containing 0.1% BSA. Cells were then stimulated with Ang II (10 )7 m; Sigma, St Louis, MO, USA) dissolved in serum-free DMEM con- taining 0.1% BSA, with or without pretreatment with AG490 (10 )5 m, Sigma,) for 16 h before the addition of Ang II. RNA isolation and RT-PCR Total RNA was isolated from cells using TRizol reagent according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA). Reverse transcription was performed using the Superscript First Stand Synthesis System for RT-PCR (Invitrogen). The cDNA was then used as a tem- plate for PCR using specific primers for AGT (forward, 5¢-ACCTTTG AGCCT GTGCCCAT -3¢; reverse, 5¢-GCT ACA CCTCTTGCCTCAC T-3¢) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (forward, 5¢-CAGGGTGTGATG GTGGG-3¢; reverse, 5¢-GGAA GAGGA TGCGG CAG-3 ¢). The amplified RT-PCR products were separated on a 2% agarose gel containing ethidium bromide and the band intensities were quantified using NIH image j software. Nuclear protein extraction The cells were scraped into cold NaCl ⁄ P i and centrifuged (14 000 g,4°C, 10 min). After the supernatant was dis- carded, nuclear extracts were prepared by lysing the cells in ice-cold buffer containing 10 mm Hepes-KOH (pH 7.9), 10 mm KCl, 1 mm Na 3 VO 4 and 0.5% Nonidet P-40 on ice for 15 min, and then centrifuged at 1500 g to obtain cellu- lar nuclei. The nuclei were washed in lysis buffer without Nonidet P-40 and centrifuged again at 1500 g for 5 min. The supernatant was removed and the pellet was resus- pended in nuclear resuspension buffer (20 mm Hepes-KOH, pH 7.9, 400 mm NaCl, 1 mm EDTA, 0.1 mm EGTA, 1 mm phenylmethanesulfonyl fluoride, 1 mm Na 3 VO 4 ,1mm dith- iothreitol), vigorously vortexed for 10 s and then centri- fuged at 1500 g for 5 min. The supernatant was separated into aliquots for use in western blotting and EMSAs. Immunoprecipitation (CoIP) and western blot analysis Equal amounts of proteins were incubated overnight at 4 °C with 1 lg of antibodies to STAT5B and to c-Jun (Santa Cruz Biotechnologies, Santa Cruz, CA, USA). Immune complexes were precipitated with 20 lLof protein A–Sepharose beads (Santa Cruz), extensively washed, separated by electrophoresis on an 8% SDS-poly- acrylamide gel and then electrophoretically transferred to poly(vinylidene difluoride) membranes (Millipore Co., Billerica, MA, USA). The membrane was incubated with anti-phospho-Ser, anti-PY99, anti-STAT5B or anti-c-Jun IgGs (1 : 1000; Santa Cruz), followed by a secondary anti-rabbit IgG (1 : 20 000; Santa Cruz), using the chemi- luminescence protocol (Santa Cruz). EMSA The sequences of double-strand oligonucleotide fragments containing the STAT5-binding site ()172 to )163 bp) or the AP-1-binding site ()427 to )402 bp) in the rat AGT gene promoter were 5¢-CTAGGG TTCCTGGAAGG GACCC-3¢, and 5¢-AGAGCCGC TGATGACTTATGAGA STAT5B and AP-1 interaction in AGT gene activation M. Han et al. 1726 FEBS Journal 276 (2009) 1720–1728 ª 2009 The Authors Journal compilation ª 2009 FEBS GGT-3¢, respectively. Nuclear extracts (10 lg) were incu- bated for 30 min with oligonucleotide probes end-labeled with [ 32 P]dATP[cS] and then loaded onto a 6% nondenatu- rating polyacrylamide gel, as described previously [21,35]. When specified, the reaction proceeded in the presence of 2 lg of anti-c-Jun or anti-STAT5B IgGs. Chromatin immunoprecipitation assay VSMCs were treated with Ang II (10 )7 m) for the time peri- ods indicated and were then fixed with 1% formaldehyde. ChIP assays were performed using 2 lL of anti-c-Jun or anti-STAT5B IgGs, as described previously [35]. An aliquot of the cell lysates was used to isolate total input DNA. PCR amplification of the immunoprecipitated DNA was per- formed using primers specific for the AP-1-binding site or the STAT5B-binding site in the AGT gene promoter. The sequences of the PCR primers were as follows: AP-1-binding site ()644 to )381 bp), 5¢-ACTCAAGGGCGGTGCTCT GA-3¢ and 5¢-TGGCAGATGAGCTTCAGGCA-3¢; and STAT5B-binding site ()200 to )60 bp), 5¢-TGCCTGA AGCTCATCTGCCACTAG-3¢ and 5¢-TAGCTCCAGCCC AGACAAGCACAG-3¢. The proteins from the immuno- precipitated chromatin fragment were eluted for western blot analysis using anti-c-Jun or anti-STAT5B IgGs. Plasmid construction The )545 to 39 bp fragment of the rat AGT gene promoter [5] was obtained by PCR using the following primers: for- ward, 5¢-GCC GGTACCGATTTCCCAACCTGACCAG ATGTGC-3¢ (KpnI site underlined); reverse, 5¢-GCC A AGCTTCTGCTTACCTTTAGCTCCAGCC-3¢ (HindIII site underlined), digested by KpnI and HindIII, and then inserted into the pGL3-basic luciferase reporter gene vector (Promega, Madison, WI, USA) linearized by KpnI–HindIII and named pGL3-AGT-Luc. For the c-Jun expression plas- mid, c-Jun cDNA was obtained from the pBIISK(-)-Jun plasmid by EcoRI digestion, inserted into the pcDNA3.1 vector and sequenced. Transient transfection and luciferase assay 293A cells were grown to 60% confluence in six-well plates and transfected with Lipofectamine 2000 Reagent (Invitro- gen), as described by the manufacturer. The transfection was performed using 1 lg of pGL3-AGT-Luc reporter plas- mid and c-Jun expression plasmid or STAT5B expression plasmid (gifted by Yu-Lee, Baylor College of Medicine) or c-Jun plus the STAT5B expression plasmid or control plas- mid pcDNA3.1. In addition, 10 ng of the renilla luciferase reporter plasmid pRL-TK (Promega) was included in each sample as an internal standard for transfection efficiency. Firefly and renilla luciferase activities were determined 48 h after the initial transfection using the Dual-Luciferase Reporter Assay System (Santa Cruz) and Flash & Glow LB 955 Tube Luminometer (Alpha Innotech HD2, San Lenndro, CA, USA). Firefly luciferase values were normal- ized on the basis of the renilla luciferase values. Statistical analysis Results are expressed as means ± SD, and an analysis of variance with Bonferroni’s test was used for the statistical analysis of multiple comparisons of data. P-values of less than 0.05 were considered statistically significant. Acknowledgements This work was supported by the National Natural Science Foundation of China (nos 30670845 and 30770787), the ‘973’ Program of China (nos 2008CB517402) and the Hebei Province Natural Science Foundation (nos C2006000814 and C2005000722). References 1 Pfeffer JM, Fischer TA & Pfeffer MA (1995) Angioten- sin-converting enzyme inhibition and ventricular remod- eling after myocardial infarction. Annu Rev Physiol 57, 805–826. 2 Moreau P, d’Uscio LV, Shaw S, Takase H, Barton M & Luscher TF (1997) Angiotensin II increases tissue endo- thelin and induces vascular hypertrophy: reversal by ET(A)-receptor antagonist. Circulation 96, 1593–1597. 3 Jeunemaitre X, Soubrier F, Kotelevtsev YV, Lifton RP, Williams CS, Charru A, Hunt SC, Hopkins PN, Wil- liams RR, Lalouel JM et al. (1992) Molecular basis of human hypertension: role of angiotensinogen. Cell 71, 169–180. 4 Corvol P & Jeunemaitre X (1997) Molecular genetics of human hypertension: role of angiotensinogen. Endocr Rev 18, 662–677. 5 Mascareno E, Dhar M & Siddiqui MA (1998) Signal transduction and activator of transcription (STAT) pro- tein-dependent activation of angiotensinogen promoter: a cellular signal for hypertrophy in cardiac muscle. Proc Natl Acad Sci USA 95, 5590–5594. 6 Pan J, Fukuda K, Kodama H, Makino S, Takahashi T, Sano M, Hori S & Ogawa S (1997) Role of angiotensin II in activation of the JAK ⁄ STAT pathway induced by acute pressure overload in the rat heart. Circ Res 81, 611–617. 7 Schieffer B, Bernstein KE & Marrero MB (1996) The role of tyrosine phosphorylation in angiotensin II mediated intracellular signaling and cell growth. J Mol Med 74, 85–91. M. Han et al. STAT5B and AP-1 interaction in AGT gene activation FEBS Journal 276 (2009) 1720–1728 ª 2009 The Authors Journal compilation ª 2009 FEBS 1727 8 McWhinney CD, Dostal D & Baker K (1998) Angio- tensin II activates Stat5 through Jak2 kinase in cardiac myocytes. J Mol Cell Cardiol 30, 751–761. 9 Marrero MB, Schieffer B, Paxton WG, Heerdt L, Berk BC, Delafontaine P & Bernstein KE (1995) Direct stim- ulation of Jak ⁄ STAT pathway by the angiotensin II AT1 receptor. Nature 375, 247–250. 10 Guo Y, Mascareno E & Siddiqui MA (2004) Distinct components of Janus kinase ⁄ signal transducer and acti- vator of transcription signaling pathway mediate the regulation of systemic and tissue localized renin-angio- tensin system. Mol Endocrinol 18, 1033–1041. 11 Xu W, Comhair SA, Zheng S, Chu SC, Marks-Koncza- lik J, Moss J, Haque SJ & Erzurum SC (2003) STAT-1 and c-Fos interaction in nitric oxide synthase-2 gene activation. Am J Physiol 285, L137–L148. 12 Schuringa JJ, Timmer H, Luttickhuizen D, Vellenga E & Kruijer W (2001) c-Jun and c-Fos cooperate with STAT3 in IL-6-induced transactivation of the IL-6 respone element (IRE). Cytokine 14, 78–87. 13 Zhang X, Wrzeszczynska MH, Horvath CM & Darnell JE Jr (1999) Interacting regions in Stat3 and c-Jun that participate in cooperative transcriptional activation. Mol Cell Biol 19, 7138–7146. 14 Chinenov Y & Kerppola TK (2001) Close encounters of many kinds: Fos-Jun interactions that mediate tran- scription regulatory specificity. Oncogene 20, 2438–2452. 15 Shaulian E & Karin M (2001) AP-1 in cell proliferation and survival. Oncogene 20, 2390–2400. 16 van Dam H & Castellazzi M (2001) Distinct roles of Jun : Fos and Jun : ATF dimers in oncogenesis. Onco- gene 20, 2453–2464. 17 Ghislain JJ, Wong T, Nguyen M & Fish EN (2001) The interferon-inducible Stat2:Stat1 heterodimer preferen- tially binds in vitro to a consensus element found in the promoters of a subset of interferon-stimulated genes. J Interferon Cytokine Res 21, 379–388. 18 Haque SJ & Williams BR (1998) Signal transduction in the interferon system. Semin Oncol 25, 14–22. 19 Ihle JN (1996) STATs: signal transducers and activators of transcription. Cell 84, 331–334. 20 Lee PJ, Camhi SL, Chin BY, Alam J & Choi AM (2000) AP-1 and STAT mediate hyperoxia-induced gene transcription of heme oxygenase-1. Am J Physiol 279, L175–L182. 21 Look DC, Pelletier MR, Tidwell RM, Roswit WT & Holtzman MJ (1995) Stat1 depends on transcriptional synergy with Sp1. J Biol Chem 270, 30264–30267. 22 Klett C, Nobiling R, Gierschik P & Hackenthal E (1993) Angiotensin II stimulates the synthesis of angio- tensinogen in hepatocytes by inhibiting adenylylcyclase activity and stabilizing angiotensinogen mRNA. J Biol Chem 268, 25095–25107. 23 Sahar S, Dwarakanath RS, Reddy MA, Lanting L, Todorov I & Natarajan R (2005) Angiotensin II enhances interleukin-18 mediated inflammatory gene expression in vascular smooth muscle cells: a novel cross-talk in the pathogenesis of atherosclerosis. Circ Res 96, 1064–1071. 24 Meydan N, Grunberger T, Dadi H, Shahar M, Arpaia E, Lapidot Z, Leeder JS, Freedman M, Cohen A, Gazit A et al. (1996) Inhibition of acute lymphoblastic leukae- mia by a Jak-2 inhibitor. Nature 379 , 645–648. 25 Amiri F, Venema VJ, Wang X, Ju H, Venema RC & Marrero MB (1999) Hyperglycemia enhances angiotensin II-induced janus-activated kinase ⁄ STAT signaling in vas- cular smooth muscle cells. J Biol Chem 274, 32382–32386. 26 Shaw SS, Schmidt AM, Banes AK, Wang X, Stern DM & Marrero MB (2003) S100B-RAGE-mediated augmen- tation of angiotensin II-induced activation of JAK2 in vascular smooth muscle cells is dependent on PLD2. Diabetes 52, 2381–2388. 27 Kim S & Iwao H (2000) Molecular and cellular mecha- nisms of angiotensin II-mediated cardiovascular and renal diseases. Pharmacol Rev 52, 11–34. 28 Cao H, Dronadula N, Rizvi F, Li Q, Srivastava K, Gerthoffer WT & Rao GN (2006) Novel role for STAT-5B in the regulation of Hsp27-FGF-2 axis facili- tating thrombin-induced vascular smooth muscle cell growth and motility. Circ Res 98, 913–922. 29 Cui Y, Riedlinger G, Miyoshi K, Tang W, Li C, Deng CX, Robinson GW & Hennighausen L (2004) Inactiva- tion of Stat5 in mouse mammary epithelium during preg- nancy reveals distinct functions in cell proliferation, survival, and differentiation. Mol Cell Biol 24, 8037–8047. 30 Wang D, Stravopodis D, Teglund S, Kitazawa J & Ihle JN (1996) Naturally occurring dominant negative vari- ants of Stat5. Mol Cell Biol 16, 6141–6148. 31 Matsumura I, Kitamura T, Wakao H, Tanaka H, Hashimoto K, Albanese C, Downward J, Pestell RG & Kanakura Y (1999) Transcriptional regulation of the cyclin D1 promoter by STAT5: its involvement in cyto- kine-dependent growth of hematopoietic cells. EMBO J 18, 1367–1377. 32 Versteeg HH, Spek CA, Slofstra SH, Diks SH, Richel DJ & Peppelenbosch MP (2004) FVIIa:TF induces cell survival via G12 ⁄ G13-dependent Jak ⁄ STAT activation and BclXL production. Circ Res 94, 1032–1040. 33 Yang G & Sigmund CD (1998) Regulatory elements required for human angiotensinogen expression in HepG2 cells are dispensable in transgenic mice. Hyper- tension 31, 734–740. 34 Dronadula N, Liu Z, Wang C, Cao H & Rao GN (2005) STAT-3-dependent cytosolic phospholipase A2 expres- sion is required for thrombin-induced vascular smooth muscle cell motility. J Biol Chem 280, 3112–3120. 35 Han M, Wen JK, Zheng B, Cheng Y & Zhang C (2006) Serum deprivation results in redifferentiation of human umbilical vascular smooth muscle cells. Am J Physiol 291, C50–C58. STAT5B and AP-1 interaction in AGT gene activation M. Han et al. 1728 FEBS Journal 276 (2009) 1720–1728 ª 2009 The Authors Journal compilation ª 2009 FEBS . Synergistic co-operation of signal transducer and activator of transcription 5B with activator protein 1 in angiotensin II-induced angiotensinogen gene activation in vascular smooth muscle cells Mei. region of the angiotensinogen gene. We examined whether the elements for activator protein 1 and STAT5B function in angiotensinogen gene activation induced by angiotensin II in vascular smooth muscle. accepted 12 January 2009) doi :10 .11 11/ j .17 42-4658.2009.06902.x The binding sequences for signal transducer and activator of transcription (STAT) and activator protein 1 have been found in the promoter