... as an auxiliary tool for evaluating the accuracy of bag-valve mask ventilation The main conclusion is that when patients are well under anaesthesia, are hemodynamically stable and adequately ... invasive blood pressure (AISYS, Datex Ohmeda, WI, USA) and capnography built with mainstream technology (EMMA™ Emergency Capnometer, PHASEIN AB, Danderyd, Sweden) attached toa bag-valve apparatus ... without evacuation of the axilla as well as other breast reconstruction work The patient median age was 56 years (range 40-77) and they were all classified as ASA I or II according to the American Society...
... search of alternative semiquatitative methods Recently, a flow cytometrybased assay and a fluorescent focus assay for flavivirus quantitation have been reported [10,11] Results An attractive alternative ... that the Platelia™ Dengue NS1 AG assay can be use as a surrogate, easy and fast method for the semiquantitation of DEN in cultured cells Reliable levels of NS1 protein for quantitation are usually ... evaluated the useof Platelia™ Dengue NS1 AG as a surrogate method to monitor semiquantitatively DEN replication in cultured cells Our results indicate that this commercial assay could be a useful...
... non-essential amino acids, 1.0 mM sodium pyruvate and 10% heat-inactivated, gamma-irradiated fetal bovine serum (FBS) (HyClone Laboratories, Salt Lake City, Utah) AK-D cells (CCL-150) were maintained ... from a known infectious cDNA sequence for subgroup A, A2 strain, [34] was synthesized with optimal codon usage for expression in mammalian cells and all potential polyadenylation sites (AATAAA) and ... protein and a transcriptional transactivator fusion protein consisting of the GAL4 DNA-binding domain fused to the activation domain of NFκB These effector cells were mixed with a separate set of reporter...
... on each day of the fermentation sampled pH values tended to decrease with length of fermentation time West African cocoa usually has a pH of around 5.1 The results indicate that a fermentation ... usually applied and this results in brown bean percentages acceptable to buyers In comparable countries such as Malaysia or Indonesia, seven days pod storage and six day fermentation periods are ... 17 demonstrates an increase in pH values with length of fermentation time for all box fermentation treatments It also demonstrates higher pH values for washed beans for each day of all fermentation...
... facilitate entry into adequate care Key advantages include the ability to draw inference to the population of patients in care for HIV infection, and beginning in 2008, the availability of annual ... AIDS case to the health department; some providers of care may have been left off the sampling frame if they had never reported an HIV case However, two of the participating states had laboratory ... had a local requirement that provider submit a letter of intent to participate, which may have been an impediment to participation Information was abstracted from the medical records of 915 patients...
... leukocytoclastic vasculitis in a 33-year-old African American woman secondary to the useof naproxen resulting in multi-limb ischemia and subsequent amputation Adding yet another pharmaceutical to the ... diagnosis applied to our patient We reiterate that amputation in this scenario was an unfortunate and Page of debilitating last resort once all therapeutic modalities failed to improve her gangrene ... a known offending agent, skin manifestations of palpable purpura, rash, biopsy of leukocytoclasis A diagnosis of druginduced naproxen [Naprosyn] leukocytoclastic vasculitis was thus made The...
... Steinhausen et al BMC Psychiatry 2010, 10:15 http://www.biomedcentral.com/1471-244X/10/15 Page of Correction After the publication in this journal [1] we became aware of the fact that the article ... manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance ... doi:10.1186/1471-244X-10-15 Cite this article as: Steinhausen et al.: Correction: Frequency, course and correlates of alcohol use from adolescence to young adulthood in a Swiss community survey BMC Psychiatry 2010 10:15...
... CGGTCATGGTGGCGAATAA Probe TCCTGCAAAAATCCCTTCAACT QPCR tag primer CCCCACTTTATAGATGTTTTTGTTCA Negative sense-specific QPCR primer FAM-TTGGTATAGCACAATCTTCTACCAGAGGTGGC-TAMRA Sequence contains an EcoRI ... ATAGGATCCTGCTAAGACTCCCCACCGTAA2 Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAATCCTGCAAAAATCCCTTCAACT3 Negative sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAAACTTTATAGATGTTTTTGTTCA3 Positive ... than the cotton rat [19], constitutes a more practical model due to the availability ofa larger number of immunological and molecular reagents as well as the availability of transgenic animals...
... McNemar Test Comparisons between risk groups and controls were based on univariate and multivariate analyses of covariance (ANCOVA and MANCOVA) with sex and age as the controlled covariates http://www.capmh.com/content/1/1/12 ... Impact Active Coping Avoidant Coping Self-Esteem Self-Awareness Maternal Acceptance Maternal Rejection Maternal Control Paternal Acceptance Paternal Rejection Paternal Control Competition at ... perceived parental acceptance and higher rejection at both times during adolescence is a marker of PSU Avoidant coping as an additional correlate of substance use at risk was identified only at time...
... least 0.05 unit PRBC/patient/day with a standard deviation of 0.15 units PRBC/patient/day Statistical analysis We expressed variables as means ± standard deviations and numbers (percentages), and ... medical ICU of the author's hospital YHS is a registrar in the division of respiratory and critical care of the author's hospital DP is a research assistant CYH is the head of the biostatistics ... the primary cause of ICU admission Patients were followed up till hospital discharge, death or up to 28 days of ICU stay, whichever was later Device We used the Venous Arterial blood Management...
... participants of the HA-ID study at baseline (black bars) and after 3-year follow-up (gray bars) Falls, especially if accompanied with a fracture, can be considered negative health outcomes and ... related to an age-related decline in health Since falls, in the general population, increase with age, this contributes to the explanation that age-related frailty is associated to increased fall ... observe an increase in falls with age Also, the explained variance of the model was low (explained variance = 13%) and mainly related to previous falls, indicating that other factors, such as epilepsy,...
... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... tip of the red, positive lead on the positive side ofa battery Put the tip of the black, negative, lead on the other end ofa battery a Is any number showing up on the multimeter? _If not, make ... _ Name one important function ofa multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3.1.1...
... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... tip of the red, positive lead on the positive side ofa battery Put the tip of the black, negative, lead on the other end ofa battery a Is any number showing up on the multimeter? _If not, make ... _ Name one important function ofa multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3.1.1...
... and install all available updates Enable automatic updates if your vendors offer it; that will ensure your software is always updated, and you won’t have to remember to it yourself Many operating ... daily, and vendors frequently make new signatures available, so antivirus software will be most effective if the signatures are up to date Many antivirus and antispyware programs offer automatic ... Software Installing an antivirus and antispyware software program and keeping it up to date is a critical step in protecting your computer Many types of antivirus and antispyware software can detect...
... Stutz 1996 Bayesian classification (AutoClass): Theory and results In Fayyad, Piatetsky-Shapiro, Smyth, and Uthurusamy, editors, Advances in Knowledge Discovery and Data Mining AAAI Press/MIT ... of manual tagging Natural Language Engineering J Carletta 1996 Assessing agreement on classification tasks: The kappa statistic Computational Linguistics, 22(2):249-254 W Chafe 1986 Evidentiality ... Kappa values, and raises the average agreement among the judges toa Kappa value of over 0.87 for the sentences that can be tagged with certainty Using only simple features, the classifier achieves...
... Several studies have already evaluated the assessment capability of trajectory tracking task with subjects with stroke-induced impairments It has been demonstrated that the motor functional level ... instruments, but also leave several fundamental questions unanswered First, to date the majority of biomechanical upper-extremity evaluations involve reaching and trajectory tracking performed at a limited ... features [33] These toolboxes are outlined below: • The Range of Capacity (ROC) toolbox can be used to assess the user's initial and final capability ROM when using an input device and optionally...
... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT 64 TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG ... -GTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAGAAAGGTGGCGGCT || |||||| || | |||||| |||||||||||||| || |||||||| || ||||||| 1723 CGT-GTACGTAGGAAACAACAACGAATACCGCATCAGCCTGGCCAAGAAGGGCGGCGGCT 301 302 GTCCC-GTGATGAACCTGCACGCCGAATACAC-CACTTCGTTTGA-GAGTTTCATCGACA ... CCGTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAG P S Y V G T N N E Y R I S L A K AAAGGTGGCGGCTGTCCCGTGATGAACCTGCACGCCGAATACACCACT K G G G C P V M N L H A E Y T T TCGTTTGAGAGTTTCATCGACAAGGTGATATGGTACAACTTTTACAAG S F E...
... database but a 2.5D database, in a dat format similar to the one used by commercial RO software After calibration based on the approach detailed in Section 3.3, it was verified that it was suitable ... provides a high accuracy However, a disadvantage is that the size of the pixels of the spatial grid has to be very small compared to the wavelength of the signal, leading toa high complexity for large ... Chicago, Ill, USA, July 1995 [19] M Pahud, F Guidec, and T Cornu, “Performance evaluation ofa radiowave propagation parallel simulator,” in Proceedings of the 3rd International Conference on Massively...