use from to to include terminal values in a range between and to exclude them
Báo cáo hóa học: " EQ-5D visual analog scale and utility index values in individuals with diabetes and at risk for diabetes: Findings from the Study to Help Improve Early evaluation and management of risk factors Leading to Diabetes (SHIELD)" potx
... manuscript: Richard Chapman (analysis and manuscript drafting) of ValueMedics Research; and Tina Fanning (data collection and analysis) of Vedanta Research This study was presented as a poster at the ... evaluation and management of risk factors Leading to Diabetes (SHIELD) This investigation will ascertain whether the burden of having risk factors for diabetes impacts HRQoL in a similar way as having ... hypertension and dyslipidaemia: comparison of data from two national surveys Int J Clin Pract 2007, 61:737-747 American Diabetes Association: Standards of Medical Care in Diabetes – 2007 Diabetes Care...
- 7
- 611
- 1
Báo cáo toán học: "COMPOSITION SUM IDENTITIES RELATED TO THE DISTRIBUTION OF COORDINATE VALUES IN A DISCRETE SIMPLEX" pptx
... into l disjoint groups The goal of labelled counting is to establish a relation between the cardinality of the sets of hands and the cardinality of the decks For example, when dealing with labelled ... Dν − A and Dν − B, respectively The condition that f and g are unipotently equivalent amounts to the condition that Dν − A and Dν − B are related by a unipotent matrix factor Unipotent equivalence ... specified as a picture and a set of natural number labels To construct the card we label vertex in the picture by the smallest label, vertex by the next smallest label, etc Finally, a hand of weight...
- 14
- 348
- 0
Báo cáo khoa học: " Contributions to variability of clinical measures for use as indicators of udder health status in a clinical protocol" docx
... variables in a clinical examination and point to the fact that judgements of what is 'normal' and what is 'healthy' need to be viewed with a certain flexibility and in a context of farm, animal, ... Parity 40 value Acta Veterinaria Scandinavica 2006, 48:15 Figure and predicted degree lactation stage (DIM Associations between of teat end callosity = days in milk) Associations between lactation ... Explanation of the scales used in relation to each of the applied clinical variables Variable COW LEVEL Soiling – Hind part and tail Udder Teats Callus, lateral hocks Long claws Mange Explanation...
- 9
- 255
- 0
Tài liệu Use Wildcards and Ranges of Values in a SQL Query pdf
... data adapter that was created to fill the dtResults data table Last, the data table is set as the data source for dgResults Listing 6.7 frmHowTo6_3.vb: Generating Data Using LIKE and BETWEEN Statements ... ByVal e As System.EventArgs) Handles txtFromDate.TextChanged GenerateData() End Sub Private Sub txtToDate_TextChanged(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles txtToDate.TextChanged ... add the code in Listing 6.7 to create the GenerateData routine After creating the SQL statement, this routine assigns it to the Text property of lblSQLString Then the string is used in a data...
- 5
- 472
- 0
Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot
... 5¢-AAATGCTTCAATGATAT CGAAAAAGGAAG-3¢, converted a unique SspI site on the vector to an EcoRV site The mutagenesis oligonucleotides were 5¢-GTAACTGTAAGAGAACTGGTCAC-3¢ (Lys70 to Arg), 5¢-GTAACTGTAGCAGAACTGGTCA ... These values are comparable to values measured with cytochrome P460 from Nitrosomonas [3] In mutant versions of cytochrome P460 expressed in P aeruginosa, Lys70 was replaced by arginine, alanine, ... encoding wild-type cytochrome P460 from N europaea in P aeruginosa was a cytochrome with catalytic and ligand-binding capabilities and UV-visible spectroscopic properties identical to cytochrome...
- 7
- 384
- 1
báo cáo hóa học:" CCR9 interactions support ovarian cancer cell survival and resistance to cisplatin-induced apoptosis in a PI3K-dependent and FAK-independent fashion" pdf
... survival by phosphorylating and inactivating proapoptotic factors, such as FKHR and GSK-3β [7] FKHR is a transcription factor that transactivates the expression of death-activating proteins, such as ... 0.01) between treated and untreated OvCa cells decrease CCL25 also induced a gradual increase in Akt phosphorylation and 10 minutes after treatment Wortmannin treatment abrogated this increase, ... resistance to chemotherapy by means of inactivating apoptotic factors and enhancing survival pathways that antagonize apoptosis signals [2] However, the precise mechanisms of OvCa cell cisplatin-sensitivity...
- 8
- 316
- 0
Tài liệu Replacing Null Values in a Strongly Typed DataSet ppt
... typed DataSet based on the Categories table in Northwind The user specifies whether the one based on the default or annotated schema file is used In either case, data is loaded into the DataSet A ... DataAdapter SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM Categories", ConfigurationSettings.AppSettings["Sql_ConnectString"]); if (annotatedRadioButton.Checked) { // Create the typed DataSet without ... System.Data; using System.Data.SqlClient; // Table name constants private const String CATEGORIES_TABLE = "Categories"; // StringBuilder result = new StringBuilder( ); // Create the DataAdapter...
- 4
- 339
- 0
Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc
... N -terminal signal peptide (amino acids 1–36), we retained amino acid 36, an alanine, rather than using amino acid 37, a lysine, because it is known that, after a post-translational processing ... spinosum pre-pro-tyrosinase (Fig S1) can be divided approximately into three domains: a twin arginine translocase (TAT) signal peptide, a core domain containing the two copper-binding motifs and ... oxidaselike laccase gene upstream of the tyrosinase gene is also interesting because laccases are known to be capable of synthesizing melanin, albeit usually from diphenols such as epinephrine and...
- 13
- 778
- 0
Báo cáo khoa học: C-terminal truncated cannabinoid receptor 1 coexpressed with G protein trimer in Sf9 cells exists in a precoupled state and shows constitutive activity ppt
... conjugated to alkaline phosphatase and anti-polyhistidine antibody conjugated to alkaline phosphatase were obtained from Sigma-Aldrich Chemie GmbH (Munich, Germany) Anti-Gai1 ⁄ Gai2 IgG was purchased from ... GTPcS binding assay (A) Specific increase in GTPcS binding to the Gi1 (r) protein and not the GsL (j) protein in the presence of membranes containing the truncated cannabinoid receptor Symbols s and ... Biolabs GmbH, Frankfurt am Main, Germany The DH 5a strain of Escherichia coli was used to amplify and clone the DNA constructs Gai1 and GasL genes were cloned into the pDEST14 vector using Gateway...
- 10
- 313
- 0
Báo cáo hóa học: " Nano-regime Length Scales Extracted from the First Sharp Diffraction Peak in Non-crystalline SiO2 and " docx
... demonstrated that Si d-state basis Gaussian functions when included into a many-electron, ab initio calculation play a determinant role in generating a stable minimum for a Si–O–Si bond angle, H, that ... monoclinic (m-) and tetragonal (t-) grains differentiated by Hf 5d features in combination with O 2p p states that comprise local symmetry adapted linear combinations (SALCs) of atomic states into ... non-crystalline SiO2 with (1) nano-crystalline zincblende-structured ZnS grains, or (2) a fine nano-grain ceramic as in Corning cookware [33] In each of these thin materials, TEM imaging indicates that...
- 9
- 303
- 0
Báo cáo sinh học: "Biodiversity of pig breeds from China and Europe estimated from pooled DNA samples: differences in microsatellite variation between two areas of domestication" pdf
... Guizhou China, Guizhou China, Guizhou China, Hainan China, Hainan China, Hainan China, Heilongjiang China, Hubei China, Hubei China, Hubei China, Hubei China, Hunan China, Hunan China, Hunan China, ... Location China, Anhui China, Anhui China, Fujian China, Fujian China, Guangdong China, Guangxi China, Guangxi China, Guangxi China, Guangxi China, Guangxi China, Guizhou China, Guizhou China, ... Location China, Shandong China, Shanxi China, Shanxi China, Sichuan China, Sichuan China, Tibet China, Zhejiang China, Zhejiang China, Zhejiang UK (Roslin) UK (PIC) Czech Republic France France...
- 26
- 306
- 0
Thesis for the degree of Doctor of Education in TESOL EFL Female Emirati Students’ Perception of the Use of an Interactive Mathematics Software Program in a CLIL Class at the Tertiary Level
... language they are learning Indeed, the approach had to remain consistent with integrated language and content learning because both emphasize meaningful engagement and authentic language using oral ... teaching and learning” and to shift the focus from “teaching to learning, from the teacher to the learner, from memorization to creativity, reflection, imagination and innovation.” Only Emirati ... work on a program designed to teach them mathematical concepts through an approach that used more visual appeal, authentic activities, and practical applications, all to enhance their learning The...
- 208
- 350
- 1
towards sustainability of land use in a highly vulnerable and degraded
... E, and F, and they get included into soil units A and B This means that there is a loss of soil information, when mapping large areas or making soil maps at small scales At a larger scale map At ... spatially delineated later on the map Spatial generalization is a process of delineating soil polygon areas geographically and spatially onto a map This process involves map scales and mapping ... SOTER approach for estimating yield potentials at regional scale in Brazil Graef and Stahr (2000) used the SOTER approach for management of soil, terrain, and land use and vegetation data at regional...
- 230
- 583
- 0
Social inclusion and intercultural values in a school of education
... Dünyada Mentorluk Uygulamalari (pp 115–132) Ankara: Pagen Alademi Antoniou, P., & Kyriakides, L (2013) A dynamic integrated approach to teacher professional development: Impact and sustainability ... competences Improving pre- and in- service teacher training, mentorship and team-building in order to share emotional attitudes, and inclusion and intercultural experiences, and Developing inclusive competencies ... professionalism, motivation and continuous training, whereas working to promote inclusion in education is arranged as a way to answer to school diversity How teachers approach their educational work towards...
- 14
- 288
- 0
DSpace at VNU: The Brunk–Prokhorov strong law of large numbers for fields of martingale differences taking values in a Banach space
... sponsoring their working visit to University of Washington and to the Department of Mathematics, University of Washington for the hospitality This research was supported in part by Vietnam’s National ... comments and valuable suggestions which have significantly improved this paper The authors express their sincere thanks to the Advanced Math Program of Ministry of Education and Training, Viet Nam ... 1≼k≼n and we are done The following theorem gives a characterization of p-uniformly smooth Banach spaces Theorem 3.2 Let ≤ p ≤ and E be a separable Banach space Then the following statements are...
- 10
- 111
- 0
Volume 5 biomass and biofuel production 5 17 – use of biofuels in a range of engine configurations
... but also improving engine performance and endurance [58–60] De Almeida et al [60] and Agarwal and Agarwal [58] heated pure palm oil and Jatropha–diesel blends to 100 °C before supplying them to ... while inedible oils are used mainly in Asia Compared to animal fat and waste grease, vegetable oils are cleaner and well suited for producing high-quality biodiesel, as additional after-treatments ... transport applications such as automotive engines 5.17.5.1 Fuels and Fuel Properties Gas fuels used in dual fuel engines range from natural gas, synthesis gas, and landfill gas to hydrogen and biogas...
- 14
- 209
- 0
Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"
... data analysis and interpretation, and drafting of the manuscript, NS, MB, JT, JV, JV, CA, PA, EV, JCH, AY, WP and CC participated in the study design, data acquisition and drafting of the manuscript ... 250) in the standard insulin group and 36.6% (93 of 254) in the intensive insulin group ICU mortality was similar for patients of the standard insulin group and in those from the intensive insulin ... was given to 14 patients in the standard insulin group (5.6%) and 14 in the intensive insulin group (5.5%) The remaining patients received total-enteral feeding exclusively In the standard insulin...
- 9
- 635
- 0
Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot
... contain significant RNase V1 signals at both strands, whereas cleavage signals by RNase T1 and RNase A are exclusively located in the unpaired loop and joint regions, including some weak signals ... (gttgtactccagcttgtgcc) were used For the detection of the unspliced pgRNA and the SP1 splicing variant of HBV, primers SP1 (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) ... T1, RNase V1 and RNase A The T1 seq and A seq lanes represent RNase T1 and RNase A sequencing markers, respectively NC indicates the negative control RNA sample produced by adding water instead...
- 14
- 379
- 0
báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot
... expanded to Trinidad & Tobago, St Kitts & Nevis, St Lucia, St Vincent & the Grenadines, and Surinam in 2003; to Barbados and the Bahamas in 2004; and to Anguilla, Antigua & Barbuda, Dominica, ... The trainer pathway is a four-step process that assists clinicians in making the transition from health care provider to clinical trainer, then to advanced trainer and, finally, to master trainer ... or master trainer ▪ Selected advanced trainers may go on to pursue additional training in instructional design to become a master trainer, which is the "top" of the trainer pathway Master trainers...
- 8
- 450
- 0
Báo cáo khoa học: "Aboveground biomass in a beech forest and a Scots pine plantation in the Sierra de la Demanda area of northern Spain" pdf
... vegetation is subject to external environmental factors net such as soil and climate, and to inherent facsuch as age and the kind of tree cover (Santa Regina et al, 1991).Plants retain a substantial ... experimental site is located in the Sierra de la Demanda mountains in the province of Burgos and Logroño in northern Spain The topography is mountainous and its paleozoic massif is located ... mineralized, total carbon and nitrogen were determined using a Wosthoff carmograph and Macro-N Heraeus analyzer, respec- tively Data were treated with analysis of variance, considering trees belonging to...
- 9
- 261
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25