uninterruptable power supply a device which prevents data
![dictionary of e-business [electronic resource] a definitive guide to technology and business terms](https://media.store123doc.com/images/document/14/y/mw/small_mwq1401352273.jpg)
dictionary of e-business [electronic resource] a definitive guide to technology and business terms
... that of an analogue audio signal The maximum frame capture rate of a video capture card is a function of its maximum sampling rate which is linked to the maximum data rate at which it can operate ... network JavaSpaces service Jini service Data Docking bay Servlets Transaction manager Transaction participants WAP browser OS(es) Digital camera Backend TP manager HTTP servers Residential LAN Video ... America, Far East, and in the Asia Pacific region including Australia and New Zealand In the Asia Pacific country of Japan, NTT’s MCS system was the first commercial delivery of a mobile 1G Japanese...
- 379
- 3,486
- 0
Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf
... underlying database of movie information is stored in XML format When a new database is available, a Grammar Compiler component extracts and normalizes the relevant fields from the database These are ... conjunction with a predefined multimodal grammar template and any available corpus training data to build a multimodal understanding model and speech recognition language model The user interacts with ... the evaluation Prior studies have primarily conducted qualitative evaluation with small groups of users (5 or 6) A quantitative and qualitative evaluation was conducted examining the interaction...
- 8
- 585
- 0
Báo cáo khoa học: "A speech interface for open-domain question-answering" doc
... For example, Q245 What city in Australia has rain forests? it answered correctly, but the transcription What city in Australia has rainforests (without a space), got no answers Another example: ... offers plain text as an alternative to HTML for output We have also made some cosmetic modifications for small-screen devices like shrinking the large logo Evaluation We evaluated the accuracy of ... interface is particularly applicable in a mobile context, in which text entry is slow and circumstances may prohibit speech altogether We fitted a 3-gram language model to the same corpus as above...
- 4
- 276
- 0
Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot
... Figure 1: Architecture This architecture forms an ideal platform for the implementation of the phonological interface Necessary adaptions are limited to the data used: An existing grammar was extended ... markers, which have scope over any phonological material between a nuclear tone and the right boundary of an intonation phrase.) While these representations clearly encode some fragment of atltosegmental ... sequence paradigm The handling of accentuation and phrmsing by the generator resembles the syntacto-semantic approaches Only a few tags such as emphasis [EMPH] and (conceptual or textual) givenness...
- 5
- 498
- 0
Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc
... e ı a Measures for Automatic Machine Translation Evaluation Machine Translation, 24(3–4):77–86 Ahmed El Kholy and Nizar Habash 2011 Automatic Error Analysis for Morphologically Rich Languages ... Error Analysis and Proposed Solutions for the Catalan—Spanish Language Pair LREC, 45(2):181–208 Mark Fishel, Ondˇej Bojar, Daniel Zeman, and Jan Berka r 2011 Automatic Translation Error Analysis ... levels and generates an interactive table of scores displaying the values for all the measures Table organiza- 142 Graphically-aided Error Analysis and Diagnosis Human analysis is crucial in the...
- 6
- 453
- 0
Lab 3.1.5 Configuring a Serial Interface
... the name and passwords for Router a On Router 1, enter the global configuration mode and configure the hostname as shown in the chart b Configure the console, virtual terminal and enable passwords ... GAD a Enter the command show interface serial on GAD Refer to interface chart GAD#show interface serial This will show the details of interface serial b List at least three details discovered by ... the name and passwords for Router a On the Birmingham router, enter the global configuration mode Configure hostname, console, virtual terminal and enable passwords as shown in the previous chart...
- 5
- 341
- 0
Tài liệu Lab 3.1.5 Configuring a Serial Interface pptx
... uses the startup configuration when the router is started Step Display information about Serial interface on GAD a Enter the command show interface serial on GAD Refer to interface chart GAD#show ... passwords lab Step Configure serial interface Serial From the configure terminal mode, configure serial interface Serial on Router GAD Refer to interface chart GAD(config)#interface serial GAD(config-if)#ip ... about Serial interface on BHM a Enter the command show interface serial on BHM Refer to interface chart BHM#show interface serial This will show the details of interface serial b List at least following...
- 5
- 535
- 0
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface doc
... Paris interface as listed Configure the Paris router serial interface as follows: Paris(config)#interface serial Paris(config-if)#ip address 192.168.15.2 255.255.255.0 Paris(config-if)#clockrate ... the Paris router using the NO version of the command and then add it to the London router configuration Step Enter the command show interface serial on Paris Paris#show interface serial a Serial0 ... interface chart) on Paris Paris#show interface serial This will show the details of interface serial Answer the following questions: a Serial is _, line protocol is _ b Internet address...
- 6
- 368
- 0
Tài liệu Troubleshooting a Serial Interface doc
... Paris interface as listed Configure the Paris router serial interface as follows: Paris(config)#interface serial Paris(config-if)#ip address 192.168.15.2 255.255.255.0 Paris(config-if)#clockrate ... the Paris router using the NO version of the command and then add it to the London router configuration Step Enter the command show interface serial on Paris Paris#show interface serial a Serial0 ... interface chart) on Paris Paris#show interface serial This will show the details of interface serial Answer the following questions: a Serial is _, line protocol is _ b Internet address...
- 6
- 275
- 0
Tài liệu Lab 3.1.5 Configuring a Serial Interface ppt
... uses the startup configuration when the router is started Step Display information about Serial interface on GAD a Enter the command show interface serial on GAD Refer to interface chart GAD#show ... passwords lab Step Configure serial interface Serial From the configure terminal mode, configure serial interface Serial on Router GAD Refer to interface chart GAD(config)#interface serial GAD(config-if)#ip ... about Serial interface on BHM a Enter the command show interface serial on BHM Refer to interface chart BHM#show interface serial This will show the details of interface serial b List at least following...
- 5
- 431
- 0
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface pdf
... Paris interface as listed Configure the Paris router serial interface as follows: Paris(config)#interface serial Paris(config-if)#ip address 192.168.15.2 255.255.255.0 Paris(config-if)#clockrate ... the Paris router using the NO version of the command and then add it to the London router configuration Step Enter the command show interface serial on Paris Paris#show interface serial a Serial0 ... interface chart) on Paris Paris#show interface serial This will show the details of interface serial Answer the following questions: a Serial is _, line protocol is _ b Internet address...
- 6
- 323
- 0
Tài liệu Báo cáo khoa học: "An ERP-based Brain-Computer Interface for text entry using Rapid Serial Visual Presentation and Language Modeling" ppt
... high-dimensional data, singularities of these matrices are problematic RDA applies regularization and shrinkage procedures to the class covariance matrix 40 Figure 4: Single-trial EEG data at channel ... of the trial and distractor responses at channel Cz on a single-trial basis, rather than averaged over all trials The signals acquired from each EEG channel are incorporated and classified to ... 0.5 to 60 Hz, a 60 Hz notch filter, a sampling rate of 256 Hz, and we buffer the EEG data until we have samples of 16-channel EEG data, at which point the data are transmitted to the laptop We use...
- 6
- 551
- 0
Báo cáo: THIẾT BỊ LƯU TRỮ USB (Universal Serial Bus ) potx
... cấu tạo giống 07/31/14 ~^~ TỔNG QUAN VỀ USB ~^~ Mạch ASIC ( Application Specific Integrated Circuit ): não ổ đ a Flash USB Nó gồm có xử lý trung tâm 50 MHz ARM7 RISC, quản lý toàn chuyện ghi ... từ nguồn (Power Supply) chúng thiết bị sử dụng điện chuột, Digital Camera lại dùng điện (khoảng 500mA - 5V) từ Bus 07/31/14 ~^~ TỔNG QUAN VỀ USB ~^~ 10 Các đặc điểm cổng USB bao gồm: ... Joystick, Digital Camera, Webcam, Modem, loa, điện thoại, Network Connection, thiết bị lưu trữ thông tin (ổ Zip) 07/31/14 ~^~ TỔNG QUAN VỀ USB ~^~ Thông thường máy tính có hai khe cắm USB...
- 19
- 471
- 1
AN1157 a serial bootloader for PIC24F devices
... Control characters are not considered data and are not included in the checksum COMMANDS The data field for each packet contains one command and its associated data The commands are detailed in Appendix ... Inc Data EEPROM Operations Some PIC24F devices have built-in data Flash memory EEPROM The bootloader allows data Flash to be read and erased at a word level, bytes at a time Erases are done on a ... data field as a control character Within the data field, the bootloader will always accept the byte following a as data, and will always send a before any of the three control characters...
- 26
- 532
- 0
Serial Interface (SCI)
... of serial data input/output compared with that of parallel data? Enter an appropriate word in parentheses Answer It takes (longer) time for inputting/outputting the same bit count of data It uses ... design and register value settings are conducted accordingly • • • • • • Data transfer mode and level Data transfer speed Data transfer format Multiprocessor function SCI clock Interrupts during data ... programs to transmit and receive one-character data (8-bit data) written in ASCII code through start-stop synchronization using the SCI0 The following specifications are assumed here, and hardware...
- 18
- 289
- 0
Serial Interface to PIC
... draws a merely 60 A of current from the supply Onchip ADC of the PIC16F877 is used for digitization of the analog signal corresponding to the temperature data The datasheets of LM35 and OP-07 are ... Displaying Data on HyperTerminal 73 A shortcut to the configuration file can be created and placed on the desktop for easy reference HyperTerminal setup procedure is described in many technical manuals ... inherent calibration facilitates easy interfacing to the outside world As shown in Fig 4.5 Receiving sensor data on the HyperTerminal 76 Serial Interface to PIC Fig 4.5 only a unity gain amplifer...
- 10
- 271
- 0
Tài liệu Báo cáo khoa học: "A text-based search interface for Multimedia Dialectics" ppt
... offsets Also, the user may watch the video clips of the modalities that participate in the relation (e.g a particular gesture) and/or a static image (keyframe) of a participating image region (e.g a ... cross-lingual information resources for automatically expanding and generalising the data (semantic relations) one can mine from the corpus Figure 1: The COSMOROE cross-media relations For annotating a ... Further details on the hit, i.e information an advanced user would get, are available following the advanceinformation link The use of semantic relations in multimedia data, in this case, is hidden...
- 4
- 294
- 0
Báo cáo khoa học: "A spoken dialogue interface for TV operations based on data collected by using WOZ method" pptx
... from 19 channels It also enables the presentation of program in- Internet Digital broadcasting TV program database Individual profile management program Program retrieval Profile search Dialog processing ... IFR has been given the appearance of a stuffed animal One advantage of this IFR is that it can be directly touched and manipulated to create a feeling of warmth and closeness On hearing a greeting ... of data analysis Figure shows an example of dialogue data recorded during a WOZ session On analyzing collected utterances made by the subjects (1,268 utterances in total), it was found that 83%...
- 4
- 271
- 0
Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx
... TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG Location* Length GC % Tm(°C) Amplicon ... ACCTCTGCCTAATCATCTC ACTGTTCAAGCCTCCAAGCTGTGCCTTGG GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA ... WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG...
- 7
- 404
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25