two variables and their values written in mime format in this example the variables are saved in a text document called data txt
Báo cáo y học: "Diagnostic value and clinical laboratory associations of antibodies against recombinant ribosomal P0, P1 and P2 proteins and their native heterocomplex in a Caucasian cohort with systemic lupus erythematosus" pot
... doi:10.1186/ar3244 Cite this article as: Barkhudarova et al.: Diagnostic value and clinical laboratory associations of antibodies against recombinant ribosomal P0, P1 and P2 proteins and their native ... Rheumatology; ANA, antinuclear antibody; SLEDAI, Systemic Lupus Erythematosus Disease Activity Index; ALT, alanine aminotransferase; AST, aspartate aminotransferase; GGT, g-glutamyl transpeptidase; ... hematologic malignancies and other factors Another remarkable, significant clinical laboratory association was that aRibPR1+ patients had an elevated GGT value The participation of aRibPs in...
- 11
- 415
- 0
Immunological characterization of human umbilical cord lining derived cells and their therapeutic application in a diabetic mouse model
... nephropathy, retinal damage and neuropathy, lead to conditions as severe as kidney failure, blindness and limb amputation The frequency of diabetes is rising dramatically all over the world and has ... cell therapy and/ or gene therapy for the treatment of diabetes are being studied intensively For the treatment of type diabetes, the areas of cell therapy and gene therapy are closely interconnected ... PUBLICATION AND PRESENTATIONS Characterization of human umbilical cord lining derived epithelial cells and transplantation potential Zhou Y, Gan S U, Lin G, Lim Y T, Masilamani J, Mustafa F, Phua...
- 226
- 362
- 0
Báo cáo hóa học: " Research Article New Trace Bounds for the Product of Two Matrices and Their Applications in the Algebraic Riccati Equation" potx
... stabilizable, and the pair Q, A is observable In practice, it is hard to solve the ARE , and there is no general method unless the system matrices are special and there are some methods and algorithms ... real matrices We have showed that our bounds for the trace are the tightest among the parallel trace bounds in nonsymmetric case Then, we have obtained the application in the algebraic Riccati ... Inequalities and Applications 11 Applications of the Results Wang et al in have obtained the following: let K be the positive semidefinite solution of the ARE 1.4 Then the trace of matrix K has the...
- 18
- 456
- 0
Frequency of Routine and Flooding-stage Observations for Precise Annual Total Pollutant Loads and their Estimating Method in the Yodo River
... observation data excluding the monthly data Total pollutant loads during routine observations in the dry year of 2005 became small, whereas those obtained in a rainy year became larger The annual total ... compensated values of pollutant load during flooding became larger in the dry year of 2005, than in other years, and became the largest for TOC The values for inorganic ion loads became smaller than ... was a rainy year (Q: 434m3/s) and 2003 was an average year (Q: 236m3/s) During the observation periods, years with more rainfall had larger mean pollutant loads than years with less rainfall The...
- 9
- 572
- 0
Undaria pinnatifida Habitat Loss in Relation to Sea Urchin Grazing and Water Flow Conditions, and Their Restoration Effort in Ogatsu Bay, Japan
... of macroalgae and seagrass, and the population of infauna were quantified in the 50 m × m belt transects in the outer (Line 1) and inner (Line 2) bay areas by scuba divers in September 2003 and ... sea urchin Strongylocentrotus nudus (Kawai et al., 2002) U pinnatifida had inhabited in the inner areas of Ogatsu Bay, Japan, but declined during the 1990s and resulted in the formation of barren ... U pinnatifida (%) bay areas and unvegetated areas with aggregations of sea urchins in the outer bay indicated that water velocities in the inner bay were not high enough to prevent the grazing...
- 13
- 476
- 0
IDIOMS AND THEIR PROPER USE IN IELTS SPEAKING/WRITING TASKS ppt
... or they not make sense The target of the idiom needs to be appropriate for the way the words are spoken, and perhaps even the body language of the speaker In a writing task, this extra nonverbal ... used in the U.S (often spoken as: kinda) – I am kind of [kinda] tired This class is kind of [kinda] boring know something [it, this] backwards and forward – to be totally familiar with – Declarative, ... -(similar to get carried away with) – situation is about to get out of control Admonishing, declarative Don’t let those students get out of hand, they are getting carried away with their talking and...
- 10
- 1,115
- 8
Báo cáo khoa học: Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis doc
... GCTCTAGAGTTTAAACGATCTCATTGTTGGGGCGC GCTCTAGAGTTTAAACATAGTCAATGAACTTGTACGC AGGAAGGCCGGCAAATGGC TTCACGTGAGATAAGCTCCC ACGGTTTCGGTGAAGCCAG ACAATTAATTAACAGTATGTACGAGCGATGCG ACAAAAGCTTGGCGCAAATCATAGCTTCTTG ... ACAAAAGCTTGGCGCAAATCATAGCTTCTTG GACTAGTTTAAACGGATCGACGAGTTCGACGC GACTAGTTTAAACGAGGCACTGTGACCAGATGC CGTTCTGGAGCAACCTTCG GGTCGAGGAAGTACGTGAC GCTCTAGAGCAACCGTCCGAAATATTATAAA GCTCTAGATCTCATAAAAATGTATCCTAAATCAAATATC ppsE ... of viable bacteria was evaluated by plating serial dilutions of the different cultures onto 7H11 supplemented with OADC and incubation at 37 °C The values shown are the means ± standard deviations...
- 13
- 536
- 0
A BRIEF HISTORY OF PANICS AND THEIR PERIODICAL OCCURRENCE IN THE UNITED STATES pdf
... Juglar himself states that a commercial panic is always a financial panic, as a falling away of the metallic reserve indicates its breaking out; and I have only translated that portion dealing ... characterized by lack of business, steady prices, and a marked growth in available banking funds [The various tables spread through this pamphlet are fully explained by their headings and the text. ] ... idleness among workmen, a decrease in salaries and in interest rates, when the public is wary and speculation dead, and expenditures are cut down as far as possible, may be taken to mean a rapid and...
- 172
- 499
- 0
báo cáo hóa học:" Correlation between expression of p53, p21/WAF1, and MDM2 proteins and their prognostic significance in primary hepatocellular carcinoma" docx
... examinations of tumor specimens and data analysis, and drafted the manuscript ZYZ and JF participated in the interpretation of data, conducted immunohistochemistry, and western blot analysis All ... prognostic factor in HCC, but was often reported in the maxillary sinus squamous cell carcinoma [33], in Egyptian esophageal carcinoma [34], in breast carcinoma [35], prostate adenocarcinoma [36], gastric ... maxillary sinus squamous cell carcinoma Acta Otolaryngol 2005, 125:779-785 Bahnassy AA, Zekri AR, Abdallah S, El-Shehaby AM, Sherif GM: Human papillomavirus infection in Egyptian esophageal carcinoma:...
- 8
- 611
- 0
– ACT MATH TEST PRACTICE – 1. How is five hundred twelve and sixteen thousandths written in pptx
... two sides that measure × each have an area of 48 The two sides that measure × 10 each have an area of 60 The two sides that measure × 10 each have an area of 80 Since there are two of each side, ... walkway around their rectangular pool The pool’s dimensions are 12 feet by 24 feet and the width of the walkway is feet in all places Find the area of the walkway a 748 square feet b 288 square ... 13 Find the area of the figure below in in 10 in in a b c d e 79 square inches 91 square inches 70 square inches 64 square inches 58 square inches 14 Five cans of tomatoes cost $6.50 At this rate,...
- 34
- 673
- 0
WAVELET TRANSFORMS AND THEIR RECENT APPLICATIONS IN BIOLOGY AND GEOSCIENCE potx
... the filter: the higher the order is, the later the peak will appear This table contains the advantages and disadvantages comparing with each other: Table 15 Advantages and disadvantages 36 Wavelet ... between thinking a movement and keeping the mind relaxed The use of the wavelets indicates the behavior of the brain in the different bands, so it can determinate if an individual is thinking in something ... Framework 61 Milene Arantes and Adilson Gonzaga Chapter The Detection Data of Mammary Carcinoma Processing Method Based on the Wavelet Transformation 77 Meng Yao, Zhifu Tao and Zhongling Han...
- 310
- 363
- 0
Báo cáo lâm nghiệp: " Non-indigenous plant species and their ecological range in Central European pine (Pinus sylvestris L.) forests" ppt
... Figure Pine dominated woodland in the study area of the north-eastern German lowland in comparison with the total woodland cover (according to data from Hofmann [22] with no data for Berlin given) ... geological and climatic gradient of the study area The sampling was carried out according to the method of Braun-Blanquet [6] and aimed at an ecological characterisation and/ or comprehensive inventories ... pine towards natural forests, predictions are made with regard to the reversibility and irreversibility of the recorded plant invasions STUDY AREA AND DATABASE The study area is the North-eastern...
- 15
- 268
- 0
Báo cáo khoa học: "Effects of radiation therapy on tissue and serum concentrations of tumour associated trypsin inhibitor and their prognostic significance in rectal cancer patients" doc
... explore the associations between tTATI and s-TATI concentrations, before and after RT, and clinicopathological parameters, including s-CEA and s-creatinine Classification and regression tree (CRT) analysis ... conception and design of the study, statistical analysis, drafted and revised the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have ... (data not shown) and t-TATI expression was not associated to s- creatinine concentrations (data not shown) There was no significant association between age and s-creatinine (data not shown) and...
- 10
- 404
- 0
Báo cáo y học: "Chondrogenic differentiation potential of osteoarthritic chondrocytes and their possible use in matrix-associated autologous chondrocyte transplantation" pot
... conceived the study and participated in its design and coordination All authors read and approved the final manuscript Additional files The following Additional files are available online: Additional ... GCGTCCGCTACCCCATCTCTA GCGCTCTAAGGGCACATTCAGTT [GenBank:NM_001884] GAPDH GGCGATGCTGGCGCTGAGTAC TGGTTCACACCCATGACGA [GenBank:NM_000095] MMP1 TACATGCGCACAAATCCCTTCTACC GAAAAACCGGACTTCATCTCTGTCG [GenBank:NM_002421] ... 45°C Washing, staining and scanning of the microarrays were performed using the Affymetrix GeneChip equipment (Santa Clara, CA, USA) Raw expression data were normalized and subsequently analyzed...
- 14
- 533
- 0
báo cáo khoa học: "Fatty acid profiles and their distribution patterns in microalgae: a comprehensive analysis of more than 2000 strains from the SAG culture collection" docx
... speciesrich algal group Also, for each of the two classes of Stramenopiles (heterokont algae), Phaeothamniophyceae and Raphidophyceae, just two strains are maintained at the SAG and, therefore, are not ... were integrated The amount of each FAME was calculated using a defined amount (1 μg) of the internal standard tripentadecanoate and the dry weight (DW) of each sample: area of peak × μg/area of ... CorelDraw X3 Graphic suite Additional material Additional file 1: FAME database established of all SAG microalgal strains screened The database contains information about clade, phylum, class,...
- 16
- 617
- 0
báo cáo khoa học: " Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" doc
... to the experimental design and analysis SYC and JSZ conceived the study, obtained the funding, analyzed the data and finished the final manuscript All authors read and approved the final manuscript ... miRNAs from the miRBase database [21,22] were picked up as the miRNA dataset of soybean Sequences matching noncoding rRNA, tRNA, snRNA and snoRNA in the Rfam database were removed Reads overlapping ... mRNA using the Oligotex kit (Qiagen) 5’ RNA adaptor (5’-CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA-3’) was ligated to the purified mRNA by T4 RNA ligase (Ambion), followed by a reverse transcription...
- 16
- 385
- 0
Báo cáo y học: "Bench-to-bedside review: Functional relationships between coagulation and the innate immune response and their respective roles in the pathogenesis of sepsis" ppsx
... the injured site and contains the inevitable microbial contamination that occurs following a breach in the integument of this marine animal The basic elements of clotting and inflammation have ... pentasaccharides, which are found in repeating units in glycosaminoglycans and mucopolysaccharides, are necessary to bind to a highly basic, central domain in antithrombin A conformational change ... thrombin and other coagulation factors increases proinflammatory cytokine synthesis and calcium flux, alters intracellular signaling cascades such as the MAPK pathway, and induces nitric oxide synthesis...
- 16
- 347
- 0
Báo cáo y học: "Psychosocial factors and their predictive value in chiropractic patients with low back pain: a prospective inception cohort study" docx
... distressing and may reinforce fears that the cause is serious and untreatable In some individuals this may lead to feelings of helplessness and hopelessness and to withdrawal from social interaction ... correlation analysis between selected baseline and followup variables Baseline and week outcomes (bothersomeness, cut down days for activity and for work and satisfaction with care) were compared and ... evidence in relation to chiropractic patients Work-based strategies are effective, especially for sub-acute back pain [22] but are expensive and generally unavailable to small companies and the self-employed...
- 7
- 286
- 0
Báo cáo sinh học: " Precision of genetic parameters and breeding values estimated in marker assisted BLUP genetic evaluation" potx
... of two phases: data generation and analysis of the simulated data sets The number of replicates for each variant was 100 Data generation In the simulation, data was generated for a conventional ... scenario ing programs in Europe Therefore, in this study, MAS was integrated in an existing breeding program using a twostep approach as is the case for practical applications in France and Germany ... pedigree' includes actual selection candidates for progeny testing and young bulls progeny tested during the last four years In addition, all their parents and grandparents were included Animals in the...
- 10
- 327
- 0
Báo cáo sinh học: " Detection of multiple quantitative trait loci and their pleiotropic effects in outbred pig populations" pptx
... (back fat P1 and P2) were analysed in population A and three fat traits (back fat P1 and P3 and loin fat L) in population B Three growth traits, average daily gain pre test (DGP), average daily ... Koning et al [12] and Nagamine et al [13,14] the variance component analysis [15,16] and recently, Varona et al [8] have performed a Bayesian analysis [17,18] One of the advantages of variance ... PMV and CSH prepared the data and PW developed the computer program All authors have read and approved the final manuscript Acknowledgements We thank the reviewers for their helpful comments and...
- 11
- 315
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25