Báo cáo khoa học: Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis doc

Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis Roxane Sime ´ one, Patricia Constant, Wladimir Malaga, Christophe Guilhot, Mamadou Daffe ´ and Christian Chalut De ´ partement Me ´ canismes Mole ´ culaires des Infections Mycobacte ´ riennes, Institut de Pharmacologie et de Biologie Structurale, Toulouse, France Mycobacteria are the agents of several important human diseases, including tuberculosis and leprosy, and remain an important cause of mortality and morbidity worldwide. According to the World Health Organization (http://www.who.int/en/index.html), Mycobacterium tuberculosis, the causative agent of tuberculosis in humans, is responsible for more than 8 million new cases and kills 2 million people every year. Little is known about the molecular mechanisms of mycobacterial pathogenicity, but accumulated data Keywords ketoreductase; Mycobacterium tuberculosis; phenolic glycolipids; phthiocerol dimycocerosates; tuberculosis Correspondence C. Chalut, Institut de Pharmacologie et de Biologie Structurale, 205 route de Narbonne, 31077 Toulouse Cedex, France Fax: +33 5 6117 5994 Tel: +33 5 6117 5473 E-mail: Christian.Chalut@ipbs.fr (Received 12 January 2007, revised 9 February 2007, accepted 14 February 2007) doi:10.1111/j.1742-4658.2007.05740.x Phthiocerol dimycocerosates and related compounds are important mole- cules in the biology of Mycobacterium tuberculosis, playing a key role in the permeability barrier and in pathogenicity. Both phthiocerol dimyco- cerosates, the major compounds, and phthiodiolone dimycocerosates, the minor constituents, are found in the cell envelope of M. tuberculosis, but their specific roles in the biology of the tubercle bacillus have not been established yet. According to the current model of their biosynthesis, phthiocerol is produced from phthiodiolone through a two-step process in which the keto group is first reduced and then methylated. We have previ- ously identified the methyltransferase enzyme that is involved in this pro- cess, encoded by the gene Rv2952 in M. tuberculosis. In this study, we report the construction and biochemical analyses of an M. tuberculosis strain mutated in gene Rv2951c. This mutation prevents the formation of phthiocerol and phenolphthiocerol derivatives, but leads to the accumula- tion of phthiodiolone dimycocerosates and glycosylated phenolphthiodio- lone dimycocerosates. These results provide the formal evidence that Rv2951c encodes the ketoreductase catalyzing the reduction of phthiodio- lone and phenolphthiodiolone to yield phthiotriol and phenolphthiotriol, which are the substrates of the methyltransferase encoded by gene Rv2952. We also compared the resistance to SDS and replication in mice of the Rv2951c mutant, deficient in synthesis of phthiocerol dimycocerosates but producing phthiodiolone dimycocerosates, with those of a wild-type strain and a mutant without phthiocerol and phthiodiolone dimycocerosates. The results established the functional redundancy between phthiocerol and phthiodiolone dimycocerosates in both the protection of the mycobacterial cell and the pathogenicity of M. tuberculosis in mice. Abbreviations CFU, colony-forming unit; CI, competition index; DIM, diester of phthiocerol or phthiodiolone; DIM A, phthiocerol dimycocerosates; DIM B, phthiodiolone dimycocerosates; Hyg, hygromycin; Km, kanamycin; PGL, phenolglycolipid; PGL-tb, phenolglycolipid from M. tuberculosis. FEBS Journal 274 (2007) 1957–1969 ª 2007 The Authors Journal compilation ª 2007 FEBS 1957 strongly suggest that the mycobacterial cell envelope plays a key role in both the pathogenesis and resist- ance to the various hostile environments encountered by pathogenic mycobacteria during the infection pro- cess. The mycobacterial cell envelope is a complex and unusual structure [1]. A key feature of this structure is its very high lipid content, consisting of up to 60% of the dry weight of the bacteria. Among these lipids, the diesters of phthiocerol and phenolic glycolipids (PGLs) have attracted attention for years. They are specifically found in slow-growing species that include the patho- genic species Mycobacterium leprae, Mycobacterium ulcerans, Mycobacterium marinum and members of the M. tuberculosis complex [2]. In M. tuberculosis, the diesters of phthiocerol and phthiodiolone, called DIMs, are composed of a mixture of long chain b-diols that are esterified by multimethyl-branched fatty acids named mycocerosic acids [2] (Fig. 1). The chemical structures of PGLs are very similar to those of DIMs, except that they harbor a phthiocerol chain Fig. 1. Proposed biosynthetic pathway leading to DIM A and PGL-tb from DIM B and glycosylated phenolphthiodiolone dimycocerosates, respectively. The keto, hydroxyl and methoxyl groups are boxed in rectangles. p, p¢ ¼ 2–4; n, n¢ ¼ 16–18; m2 ¼ 15–17; m1 ¼ 20–22; R ¼ C 2 H 5 or CH 3 . Phthiocerol dimycocerosates in M. tuberculosis R. Sime ´ one et al. 1958 FEBS Journal 274 (2007) 1957–1969 ª 2007 The Authors Journal compilation ª 2007 FEBS x-terminated by an aromatic nucleus, the so-called phenolphthiocerol, which in turn is glycosylated [2] (Fig. 1). In M. tuberculosis the major constituents, phthiocerol dimycocerosates (DIM A) and glycosylated phenolphthiocerol dimycocerosates (PGL-tb), are usu- ally accompanied by minor structural variants, called phthiodiolone dimycocerosates (DIM B) and phenol- phthiodiolone dimycocerosates, which contain a keto group in place of the methoxy group at the terminus of the b-diols (Fig. 1). Several laboratories have shown that both DIMs and PGLs contribute to the permeability barrier formed by the cell envelope of M. tuberculosis and to virulence [3–6]. Nevertheless, their precise molecular mechanisms of action are still unknown, and the speci- fic roles of the various members of the DIM family, e.g. DIM A and DIM B, in these functions have never been investigated. The recent developments in our understanding of the biosynthetic pathway of DIMs have provided the means to investigate the contribu- tion of these compounds to the biology of M. tubercu- losis. Considerable efforts, started more than 40 years ago, have been devoted to deciphering the complex biosynthetic pathways of DIMs and PGLs. These efforts have led to the identification of more than 20 proteins required either for the formation or for the translocation of these compounds [7]. Remarkably, most of these genes are clustered in a 70 kb region of the M. tuberculosis chromosome [3,4,8]. Several lines of evidence indicate that DIM A is formed from DIM B in a two-step process [9]: the reduction of the keto function carried by DIM B into a hydroxyl group, to form phthiotriol dimycocerosates, followed by the methylation of the hydroxyl group, catalyzed by a methyltransferase, to yield DIM A (Fig. 1). This model is supported by the characterization of the two enzymes responsible for these enzymatic reactions. Indeed, we previously showed that the protein encoded by Rv2952 catalyzes the methylation of phthiotriol and phenolphthiotriol to form phthiocerol and phenol- phthiocerol, respectively [10]. Subsequently, Onwueme et al. [11] identified Rv2951c as being the gene enco- ding the phthiocerol ketoreductase that catalyzes the reduction of the keto moiety in phthiodiolone during DIM biosynthesis. However, the role of Rv2951c has been investigated in M. ulcerans and Mycobacterium kansasii by gene complementation studies, and no formal evidence that Rv2951c has the same function in M. tuberculosis has been reported to date. In this article, we describe the contruction of an Rv2951c M. tuberculosis mutant. Biochemical analyses of this strain demonstrated that Rv2951c catalyzes the reduction of the keto moiety of both DIM B and phenolphthiodiolone dimycocerosates in M. tuber- culosis. Comparison of the phenotypes of this Rv2951c mutant with those of the wild-type strain and a mutant deficient in DIM production demonstrates that DIM A and DIM B fulfil redundant functions regarding both the resistance of M. tuberculosis to SDS and its viru- lence in the mouse model. Results Disruption of the Rv2951c gene in M. tuberculosis H37Rv and biochemical characterization of the Rv2951c gene-disrupted mutant It has recently been proposed that Rv2951c encodes an oxydoreductase involved in the reduction of the keto group of DIM B to yield phthiotriol dimycocerosates, which in turn would be methylated to give DIM A [11]. This proposal was based on the observation that some M. ulcerans and M. kansasii strains naturally produce DIM B but not DIM A, and that M. ulcerans harbored a mutation within the Rv2951c ortholog. Gene complementation studies with a multicopy plas- mid carrying a functional Rv2951c ortholog from M. marinum partially restored DIM A synthesis in the recombinant strains [11]. Although these studies strongly suggested that Rv2951c catalyzes the reduc- tion of the keto group of DIM B, the role of Rv2951c remains to be demonstrated. To formally establish the function of this enzyme in the synthesis of DIM in M. tuberculosis, we construc- ted an Rv2951c knockout M. tuberculosis H37Rv mutant strain, named PMM74, by replacing the wild-type allele of Rv2951c with a kanamycin (km)-dis- rupted allele using the temperature-sensitive ⁄ sacB proce- dure [12] (supplementary Fig. S1A). Lipids were then extracted from the PMM74 mutant and analyzed by TLC. As shown in Fig. 2A, the disruption of Rv2951c in M. tuberculosis selectively abolished the production of DIM A but not that of DIM B. When equivalent amounts of lipids were loaded on TLC plates, we observed that the mutant cells accumulated more DIM B than did the wild-type cells. To further quantify the lipids produced by the various strains, cells were labeled with [1- 14 C]propionate, a precursor known to be incorporated into methyl-branched fatty acyl-contain- ing lipids, including DIMs. Analysis of the labeling (Fig. 2B) confirmed that there were no traces of DIM A in the DRv2951c::km mutant, and revealed that the amounts of DIM B accumulated by the DRv2951c::km mutant (46% of the labeled lipids) corresponded to those of DIM A + DIM B produced by the wild-type R. Sime ´ one et al. Phthiocerol dimycocerosates in M. tuberculosis FEBS Journal 274 (2007) 1957–1969 ª 2007 The Authors Journal compilation ª 2007 FEBS 1959 cells (47% of the labeled lipids). Complementation of the Rv2951c mutation by the introduction of a wild-type allele Rv2951c in the PMM74 mutant fully restored the production of DIM A (Fig. 2A), indicating that the phenotypic differences observed between the mutated and the wild-type strains relied solely on the disruption of the Rv2951c gene. Together, these results esta- blished that Rv2951c is involved in the biosynthesis of DIM A and that DIM B is a precursor of DIM A in M. tuberculosis. To further characterize the structure of the DIM- like substances produced by the PMM74 mutant, lipids exhibiting R f values similar to those of DIM A and DIM B were purified by preparative TLC and analyzed by MALDI-TOF MS. The mass spectrum of the purified lipids exhibiting a TLC mobility similar to that of DIM B showed a series of pseudomolecular ion (M +Na + ) peaks at m ⁄ z 1346, 1360, 1374, 1388, 1402, 1416, 1430, 1444, 1458, 1472, and 1486 (Fig. 3A). These values were identical to those observed in the mass spectrum of DIM B purified from the wild-type strain (data not shown), confirm- ing that PMM74 still produced DIM B. In sharp con- trast, no pseudomolecular ion peaks that would correspond to DIM A were seen in the mass spectrum of purified lipids from PMM74 whose R f value was similar to that of DIM A (Fig. 3B). Indeed, the expected pseudomolecular ion (M +Na + ) peaks were observed in the mass spectrum of the DIM A from the wild-type strain at m ⁄ z 1362, 1376, 1390, 1404, 1418, 1432, 1446, 1460, 1474, 1488, and 1502 (Fig. 3C). The m ⁄ z value for each peak in this series is 16 mass units higher than that of DIM B, due to the reduction of the keto function of DIM B, fol- lowed by the methylation of the resulting hydroxyl group. Thus, inactivation of the Rv2951c gene in M. tuberculosis abolishes the production of DIM A but does not affect that of DIM B. Because the biosynthetic pathways of DIMs and PGLs are known to be closely related, we next focused on the role of Rv2951c in PGL-tb biosynthesis. Most of the M. tuberculosis strains, such as H37Rv, are devoid of PGL-tb, due to a frameshift mutation in the pks15 ⁄ 1 gene, and production of PGL-tb can be restored by introducing a functional pks15 ⁄ 1 gene into these strains [13]. Accordingly, both the PMM74 and wild-type strains were transformed with plasmid pPET1 carrying a functional M. bovis BCG pks15 ⁄ 1 gene, and the structure of the expected PGL-tb was determined after lipid extraction. The PMM74:pPET1 strain produced a major glycoconjugate exhibiting slightly higher TLC mobility than PGL-tb pro- duced from H37Rv:pPET1 (Fig. 2C). The glycolipids B C A D Fig. 2. TLC analyses of lipids extracted from the M. tuberculosis H37Rv DRv2951c::km and DppsE::km mutant strains. (A) TLC ana- lysis of DIMs from M. tuberculosis H37Rv, the PMM74 (DRv2951c::km) mutant, and the PMM74:pRS01-complemented strains. Lipids extracts were dissolved in CHCl 3 , loaded onto the TLC plate, and run in petroleum ether ⁄ diethylether (90 : 10, v ⁄ v). DIMs were visualized by spraying the plate with 10% phosphomo- lybdic acid in ethanol, followed by heating. The positions of DIM A (arrows) and DIM B (arrowheads) are indicated. (B) TLC analysis of radiolabeled DIMs from M. tuberculosis H37Rv and the PMM74 mutant strains. Lipids were visualized by using a PhophorImager system (Molecular Dynamics, Sunnyvale, CA, USA). The positions of DIM A (arrow) and DIM B (arrowheads) are indicated. (C) TLC analysis of glycolipids extracted from M. tuberculosis H37Rv, H37Rv:pPET1, and PMM74:pPET1. Lipids were dissolved in CHCl 3 and run in CHCl 3 ⁄ CH 3 OH (95 : 5, v ⁄ v). Glycoconjugates were visu- alized by spraying the TLC plate with 0.2% anthrone (w ⁄ v) in con- centrated H 2 SO 4 , followed by heating. The position of PGL-tb (arrow) is indicated. (D) TLC analysis of radiolabeled DIMs extracted from M. tuberculosis H37Rv and the PMM56 (DppsE::km) mutant strains. Lipids were visualized by using a PhophorImager system. The positions of DIM A and DIM B are indicated. Phthiocerol dimycocerosates in M. tuberculosis R. Sime ´ one et al. 1960 FEBS Journal 274 (2007) 1957–1969 ª 2007 The Authors Journal compilation ª 2007 FEBS produced by the PMM74:pPET1 and H37Rv:pPET1 strains were also analyzed by MALDI-TOF MS following purification. The mass spectrum of the PGL- like compound from the PMM74:pPET1 strain showed a series of pseudomolecular ion (M +Na + ) peaks 16 mass units lower than for PGL-tb from the wild-type strain (series of M +Na + peaks at m ⁄ z 1864, 1878, 1892, 1906, 1920, 1934, 1948, 1962, 1976, 1990, 2004, and 2018) (Fig. 4). Because the Rv2951c gene was shown to be involved in the modification of the keto group of DIM B to yield DIM A, we speculated that the glycolipid produced by the PMM74:pPET1 mutant might be a glycosylated phenolphthiodiolone dimycocerosate. To confirm this hypothesis, this glyco- lipid was further analyzed by 1 H-NMR (Fig. 5). All the proton signal resonances typical of PGL-tb were detected, with the notable exception of those corres- ponding to the methoxyl group of the phenolphthio- cerol dimycocerosate portion of PGL-tb expected at 3.32 p.p.m. (singlet, 3H) [14,15]. This observation was consistent with the absence of the proton resonance at 2.85 p.p.m. corresponding to that of the methine pro- ton of the carbon bearing the methoxyl group [14,15]. Furthermore, the proton resonances of the methyl group b (Fig. 5) was observed at 1.05 p.p.m., instead of 0.87 p.p.m. for the corresponding methyl resonances in phthiocerol and phenolphthiocerol dimycocerosates [16]. Together, these results clearly demonstrated that the PGL produced by the PMM74 mutant strain is a triglycosylated phenolphthiodiolone dimycocerosate, most likely a tri-O-methyl-fucosyl-(a1–3)-rhamnosyl- (a1–3)-2-O-methyl-rhamnosyl-a-phenolphthiodiolone dimycocerosate, and therefore that Rv2951c is also implicated in the biosynthesis of PGL-tb in M. tuber- culosis by catalyzing the reduction of the keto group of phenolphthiodiolone. Construction of a DIM-less mutant of M. tuberculosis H37Rv by disruption of the ppsE gene The construction of a M. tuberculosis mutant unable to synthesize DIM A but proficient at DIM B produc- tion, namely the PMM74 mutant strain, prompted us to address the question of the specific role of DIM A and DIM B in the biology of M. tuberculosis.We chose to compare the phenotypes of the DRv2951c::km mutant (DIM A – , DIM B + ) with those of the wild-type strain (DIM A + , DIM B + ) and those of a DIM-less mutant. The last of these was constructed by insertion ⁄ deletion within the ppsE gene which encodes a polyketide synthase required for the formation of the b-diol chain [17,18] (supplementary Fig. S1B). Bio- chemical analyses of the resulting mutant, named PMM56, confirmed that it was unable to synthesize either DIM A or DIM B (Fig. 2D). A B C Fig. 3. MALDI-TOF mass spectra of purified lipids exhibiting TLC mobilities similar to those of DIM B (A) and DIM A (B) from M. tuberculosis PMM74 and of DIM A (C) from M. tuberculosis H37Rv (wild type). R. Sime ´ one et al. Phthiocerol dimycocerosates in M. tuberculosis FEBS Journal 274 (2007) 1957–1969 ª 2007 The Authors Journal compilation ª 2007 FEBS 1961 Effect of the absence of DIM A on the susceptibility of M. tuberculosis to SDS In a previous study, we demonstrated that DIMs are involved in the resistance of the tubercle bacillus to detergent, a feature related to the cell envelope per- meability [4]. To determine the contribution of DIM A and DIM B to this resistance, we compared the sensi- tivity to SDS of three M. tuberculosis strains: the wild type (DIM A + , DIM B + ), the PMM74 mutant (DIM A – , DIM B + ), and the PMM56 mutant (DIM A – , DIM B – ). The three strains were incubated with 0.1% SDS for 1, 4 and 8 days, and their survival was then evaluated (Fig. 6). The DIM-less mutant (PMM56) was much more sensitive to SDS than the wild-type strain: after 1 day of exposure to the deter- gent, the number of colony-forming units (CFUs) was 20-fold lower for PMM56 than for the wild-type strain, confirming our previous observation [4]. In sharp contrast, no difference in CFU number was detected between the wild-type strain and the DIM A mutant (PMM74) that was still able to synthesize DIM B. The survival curves of the wild type and PMM74 were almost superimposable for the first two time points, and the number of CFUs was even higher for PMM74 than for the wild type after 8 days of incubation with SDS. These data indicate that the lack of DIM A in PMM74 did not induce an important structural cell wall modification. Effect of the absence of DIM A on the virulence of M. tuberculosis in mice DIM deficiency has been shown to be associated with virulence attenuation of M. tuberculosis in mice [3,4,8]. To investigate the role of DIM A and DIM B in this phenotypic modification, we performed in vivo compe- tition assays in mice to compare the virulence of PMM56 (DIM-less) and PMM74 (DIM A-less) mutant strains to that of the wild-type strain. Mice were infected intranasally either with a mixture of strains H37Rv:pMV361H and PMM74 or with a mix- ture of strains H37Rv:pMV361H and PMM56. The infectious dose used for each mouse was around 5 · 10 3 CFU, in a ratio (CFUs of mutant inocula- ted ⁄ CFUs of wild type inoculated) of 0.722 for the PMM74 ⁄ H37Rv:pMV361H inoculum and 0.944 for the PMM56 ⁄ H37Rv:pMV361H inoculum, as deter- mined by growth on 7H11 plates containing either kanamycin (Km) or hygromycin (Hyg). Mice were killed 1 or 21 days postinfection, and the mutant and wild-type loads in lungs and spleens were determined on the basis of growth on selective media. As expected, 21 days postinfection, we observed a marked difference between the number of CFUs of the wild-type strain and that of the PMM56 mutant strain in lungs and in the spleen (Fig. 7A). Indeed, both strains multiplied in lungs, but whereas an aver- age of 5.92 · 10 6 CFU was recovered from lungs for the wild-type strain, only 3.91 · 10 4 CFU were recov- ered for the PMM56 mutant strain. We also observed a growth defect for the DIM-less mutant in the spleen: on day 21, an average of 8.57 · 10 3 CFU was recovered for the wild-type strain against 1.24 · 10 2 CFU for the PMM56 strain. A competition index (CI) was determined by calculating the ratio of mutant to wild-type bacteria after correcting for the ratio of these strains in the inoculum. It appeared that, 21 days after infection, the ratio of PMM56 to wild-type bacteria was diminished more than 100-fold (CI ¼ 9.28 · 10 )3 ) in lungs and 18-fold (CI ¼ 5.39 · 10 )2 ) in the spleen, relative to the initial infect- ing ratio (Fig. 7B). In contrast, mycobacteria deficient in DIM A but synthesizing DIM B (the DRv2951c::km mutant) did not show significantly attenuated growth in comparison to the wild-type strain in mice. Indeed, 21 days postinfection, averages of 1.41 · 10 7 CFU and A B Fig. 4. MALDI-TOF mass spectra of the purified glycolipid from M. tuberculosis PMM74:pPET1 (A) and of PGL-tb from M. tubercu- losis H37Rv:pPET1 (B). Phthiocerol dimycocerosates in M. tuberculosis R. Sime ´ one et al. 1962 FEBS Journal 274 (2007) 1957–1969 ª 2007 The Authors Journal compilation ª 2007 FEBS of 1.50 · 10 4 CFU, respectively, were recovered from the lungs and the spleen for the wild-type strain, against 1.10 · 10 7 CFU and 1.50 · 10 4 CFU for the PMM74 mutant strain. These CFU counts esta- blished that mice infected with PMM74 had similar ratios of mutant to wild-type bacteria in both lungs and spleen after 21 days as compared to the ratio of bacteria in the initial inoculum (CI ¼ 1.04 and 1.44) (Fig. 7B). These mixed-infection experiments confirmed that DIMs are major determinants for the pathogenicity of M. tuberculosis. Moreover, the ability of the PMM74 mutant strain to replicate and persist in the lungs and spleens of mice clearly indicates that DIM A is not required for full virulence of M. tuberculosis when DIM B is produced in the mycobacterial cell at the same level as DIM A in the wild-type cell. Discussion The main objectives of this study were: (a) to fur- ther characterize the biosynthetic pathways of two Fig. 5. The 1 H-NMR spectrum of the purified glycolipid from PMM74:pPET1. The structure of the analyzed compound is shown above the spectrum (p, p¢ ¼ 2–4; n, n¢ ¼ 16–18; m ¼ 15–17; R ¼ C 2 H 5 ). The two doublets at 6.97 and 7.08 p.p.m. (g, h) are assigned to phenolic proton resonances. Three anomeric proton resonances are seen at 5.50 p.p.m. (1H, i) and 5.15 p.p.m. (2H, i¢). The four singlets at 3.5–3.6 p.p.m. (j) are assigned to sugar-linked methoxyl proton resonances. The multiplet centered at 4.83 p.p.m. (a) is attributed to methine resonances of esterified b-diol. The doublet at 1.15 p.p.m. (f) corresponds to the resonance of a methyl group in the a position of the fatty acyl residues. The signals that correspond to the resonance of the methine proton of the a carbon (d) and that of the carbon bearing the methyl group near the keto group (d¢) are observed at 2.55 p.p.m. Signals of several terminal methyl proton resonances are seen at 0.8–1.0 p.p.m. (e), consistent with the presence of multimethyl branched fatty acyl residues. The resonance of the protons of the methyl group adjacent to the keto group is seen as a signal at 1.05 p.p.m. (b). The two arrows show the proton signal resonance positions corres- ponding to the methoxyl group (expected at 3.32 p.p.m.) and the methine proton of the carbon bearing the methoxyl group (expected at 2.85 p.p.m.) of the phenolphthiocerol dimycocerosate portion in PGL-tb. R. Sime ´ one et al. Phthiocerol dimycocerosates in M. tuberculosis FEBS Journal 274 (2007) 1957–1969 ª 2007 The Authors Journal compilation ª 2007 FEBS 1963 important virulence factors for M. tuberculosis, i.e. DIMs and PGL-tb; and (b) to address the question of the function of the two related molecules DIM A and DIM B. According to the accepted model of DIM and PGL biosynthesis [17], DIM A and PGL-tb are expec- ted to be derived from DIM B and glycosylated phe- nolphthiodiolone dimycoserosates, respectively, after two enzymatic steps: the reduction of the keto group to give phthiotriol and glycosylated phenolphthiotriol dimycocerosates, and the methylation of the hydroxyl group by the previously identified methyltransferase encoded by Rv2952 [10]. Onwueme et al. [11] have demonstrated, in a recent study, that the lack of a functional Rv2951c ortholog in some M. ulcerans and M. kansasii strains was responsible for diacyl phthioc- erol deficiency in these strains. In addition, they have shown that complementation of M. ulcerans and M. kansasii with a functional Rv2951c gene from M. marinum leads to the accumulation of diacyl phthiotriols [11], indicating that Rv2951c encodes the phthiodiolone ketoreductase that catalyzes the forma- tion of phthiotriol, the substrate of the Rv2952 methyl- transferase in these strains. In the present study, we constructed and biochemi- cally characterized an M. tuberculosis strain harboring a mutation within the Rv2951c gene. Upon transfer of Fig. 6. Susceptibility to SDS of the M. tuberculosis wild-type (DIM A + , DIM B + ) (circle), PMM74 (DIM A – , DIM B + ) (triangle) and PMM56 (DIM A – , DIM B – ) (square) mutant strains. Strains were inoculated in 7H9 supplemented with ADC to which 0.1% SDS was added. The number of viable bacteria was evaluated by plating serial dilutions of the different cultures onto 7H11 supplemented with OADC and incubation at 37 °C. The values shown are the means ± standard deviations for three independent experiments. B A * Fig. 7. Competition between mutant and wild-type strains in infected mice. (A) Numbers of CFUs recovered from the lungs and the spleen of mice infected with a mixture of the wild-type H37Rv:pMV361H and DIM-less PMM56 strains (left panel) or with a mixture of the wild- type H37Rv:pMV361H and DIM A-less PMM74 strains (right panel), at 1 day (J1) or 21 days (J21) after infection. The CFU numbers were determined by plating dilutions of homogenized tissues on 7H11 media containing either Km (for CFU counts of the mutant strains) or Hyg (for CFU counts of the wild-type strain). White, black and gray bars represent the numbers of CFUs corresponding to the H37Rv:pMV361H, the PMM56 and the PMM74 strains, respectively. Values are means ± standard deviations (error bars) of CFU counts for five infected mice. *When spleen homogenates from the five mice infected with the H37Rv::pMV361H ⁄ PMM56 mixture were plated on 7H11 plates contain- ing Km, no colonies were obtained for four mice, indicating that fewer than 50 bacteria of the PMM56 mutant strain were present in the spleen of these mice. For the determination of the number of PMM56 bacteria present in the spleen of these four mice, we thus chose a value of 50 CFU per spleen. The average number of CFUs recovered from the spleen of mice infected with the H37Rv::pMV361 ⁄ PMM56 mixture is therefore overestimated for the PMM56 mutant. (B) CI for the DIM-less PMM56 (white bars) and the DIM A-less PMM74 (gray bars) mutant strains in the lungs and spleen of the infected mice after 21 days of infection. CI is defined as the ratio of mutant to wild-type CFUs in the organ divided by the mutant to wild-type bacterial ratio in the inoculum. Phthiocerol dimycocerosates in M. tuberculosis R. Sime ´ one et al. 1964 FEBS Journal 274 (2007) 1957–1969 ª 2007 The Authors Journal compilation ª 2007 FEBS plasmid pPET1, this strain accumulated both DIM B and glycosylated phenolphthiodiolone dimycoserosates, but was unable to synthesize DIM A and PGL-tb. This mutant strain did not produce the intermediates phthiotriol and glycosylated phenophthiotriol dimyco- cerosates found in the DRv2952::km mutant strain, demonstrating that the products of Rv2952 and Rv2951c are not involved in the same enzymatic step of the DIM A and PGL-tb pathway. This phenotype was not due to a polar effect on a downstream gene, as the transfer of a functional Rv2951c gene carried on a mycobacterial plasmid fully reversed this biochemical phenotype. Thus, our data extend the results reported by Onwueme et al.toM. tuberculosis, and further demonstrate that the ketoreductase encoded by Rv2951c is involved in the biosynthetic pathway of PGL-tb by catalyzing the formation of phenolphthiot- riol dimycoserosates. Previous reports have established that DIMs are important virulence factors of M. tuberculosis and contribute to the cell envelope permeability barrier [3–5,19]. However, these reports were based on the phenotypic analysis of mutants deficient in both DIM A and DIM B biosynthesis, and did not allow the precise definition of the role of each of the mole- cules. With our DIM-less and DIM A-less mutants derived from the same parental strain, we first addressed the question of the specific role of DIM A and DIM B in the resistance of cells to SDS. We demonstrated that the occurrence of comparable amounts of DIM B can complement the absence of DIM A with regard to the SDS resistance, suggesting that the two molecules fulfill redundant functions regarding the protection of the mycobacterial cell against environmental attack. These results also sug- gest that the methoxyl group located at the terminal end of the phthiocerol chain does not significantly contribute to the structural organization of the myco- bacterial cell envelope. We next used the mouse infec- tion model to investigate the effect of the lack of DIM A production on virulence attenuation of the resulting bacteria. We found that, unlike the DIM- less mutant, the mutant deficient in DIM A replicated as well as the wild-type strain in mice, indicating that: (a) DIM A is not required per se for full virulence of M. tuberculosis; and (b) DIM B can contribute to the same extent as DIM A in pathogenicity when this compound is overproduced in the mycobacterial cell. Interestingly in this experiment, the DIM-less mutant (PMM56) was clearly defective for growth in both lung and spleen, which is consistent with previous findings by Rousseau et al. [19]. These data are in contrast with those of Cox et al. [3], who found that DIMs are required for optimal growth in the lungs but not in the spleen of mice. The discrepancy between these results might be explained by the dif- ferent genetic backgrounds of the M. tuberculosis strains used in these studies or ⁄ and by different experimental conditions. Indeed, Cox et al. [3] infec- ted mice by intravenous injection with a high infec- tious dose (10 6 CFU), whereas Rousseau et al. used, like us, the intranasal route of infection and a low infectious dose (10 4 CFU). The precise molecular mechanisms by which DIMs act in the course of infection are still unclear. It is possible that DIMs contribute to pathogenicity pas- sively, by protecting the tubercle bacillus against the antimicrobial responses of the host during infection. Indeed, several lines of evidence, including our SDS experimental data, indicate that these molecules con- tribute to the structural organization of the myco- bacterial cell envelope and are involved in the cell wall permeability barrier of mycobacteria [4]. The growth defect observed for the DIM-less mutant in mice could therefore result from altered cell wall per- meability. In contrast, the PMM74 mutant strain may behave like the wild-type strain in mice because this mutant has an unaffected cell envelope organiza- tion. Alternatively, the external localization of DIMs in the cell envelope raises the possibility that these compounds act in vivo by interacting with some com- ponent of the host cell and by modulating the host immune response to contain the infection. This hypothesis is supported by recent data suggesting that DIMs modulate the host immune response in the very early steps of infection [19]. In that situ- ation, it can be inferred from our results that DIM B is able to fulfill the same function as DIM A in this immunomodulation activity, suggesting that the methoxyl group carried by DIM A is not involved in this process. Our study provides the first structure–function ana- lysis of DIMs in the pathogenicity of the tubercle bacillus. Nevertheless, more experiments are required to clarify the precise roles played by DIMs in the cell envelope architecture and in virulence. The generation of M. tuberculosis mutants producing DIM derivatives, such as the PMM74 mutant, could be very useful for addressing this issue. Indeed, the biochemical charac- terization of these mutants and the analysis of their growth characteristics in various cellular and animal models may lead to the identification of the structural motif(s) of DIMs involved in pathogenesis, and thereby provide clues to decipher the mechanism by which these compounds contribute to the pathogenesis of tuberculosis. R. Sime ´ one et al. Phthiocerol dimycocerosates in M. tuberculosis FEBS Journal 274 (2007) 1957–1969 ª 2007 The Authors Journal compilation ª 2007 FEBS 1965 Experimental procedures Bacterial strains, growth media and culture conditions Plasmids were propagated at 37 °CinEscherichia coli DH5a in LB broth or LB agar (Invitrogen, Cergy Pontoise, France) supplemented with either Km (40 lgÆmL )1 ) or Hyg (200 lgÆmL )1 ). M. tuberculosis H37Rv, PMM56 and PMM74 strains were grown at 37 °C in Middlebrook 7H9 broth (Invitrogen) containing ADC (0.2% dextrose, 0.5% BSA fraction V, 0.0003% beef catalase) and 0.05% Tween- 80 when necessary, and on solid Middlebrook 7H11 broth containing ADC and 0.005% oleic acid (OADC). For bio- chemical analyses, mycobacterial strains were grown as sur- face pellicles on Sauton’s medium. When required, Km and Hyg were used at concentrations of 40 lgÆmL )1 and 50 lgÆmL )1 , respectively. Sucrose 2% (w ⁄ v) was used to sup- plement 7H11 for the construction of the PMM74 mutant. General DNA techniques Molecular cloning experiments were performed using stand- ard procedures. The cloning vectors used were pGEM-T (Promega, Lyon, France) and pPR27 [20]. Mycobacterial genomic DNA was extracted from 5 mL of saturated cul- tures as previously described [21]. PCR experiments for plasmid constructions or genomic analysis were performed with standard conditions on a GeneAmp PCR system 2700 thermocycler (Applied Biosystems, Courtaboeuf, France). PCR was performed in a final volume of 50 lL containing 2.5 units of Pfu DNA polymerase (Promega). Construction of M. tuberculosis H37Rv gene-disrupted mutants A 2749 bp DNA fragment containing the Rv2951c gene of M. tuberculosis H37Rv flanked by 760 and 843 bp at the 5¢- and 3¢-end, respectively, was amplified by PCR from genomic DNA using oligonucleotides 2951A and 2951B (Table 1), and cloned into pGEM-T to give pCG163. An internal Rv2951c fragment of 801 bp was removed by a ClaI digestion and substituted by a km resistance cassette [22] to yield pCG167. This plasmid was subsequently digested by PmeI, and the 4542 bp fragment that contained the disrup- ted Rv2951c gene and its flanking regions was purified and inserted at the XbaI site of pPR27, a mycobacterial thermo- sensitive suicide plasmid harboring the counterselectable marker sacB, to give plasmid pCG175. This vector was elec- trotransformed in M. tuberculosis H37Rv, and transform- ants were selected on 7H11 supplemented with OADC and Km at 32 °C [12]. Two clones were selected and grown in 5 mL of 7H9 medium containing Tween-80 and Km at 32 °C for 3 weeks. Several dilutions of these cultures were then plated onto 7H11 agar plates containing OADC, Km and 2% sucrose, and incubated at 39 °C. PCR screening for disruption of Rv2951c was performed with a set of specific primers (2951C; 2951D; 2951E; res1; res2) (Table 1) after extraction of the genomic DNA from several Km- and sucrose-resistant colonies. One clone giving the correspond- ing pattern for disruption of Rv2951c was selected for fur- ther analyses and named PMM74 (supplementary Fig. S1A). To construct a DIM-less mutant of H37Rv, we chose to inactivate the ppsE gene, one of the genes shown to be involved in the formation of the phthiocerol backbone [17,18]. We used the strategy described by Bardarov et al. [23]. A 2660 bp fragment of the ppsE gene was amplified using M. tuberculosis genomic DNA and primers ppsE1 and ppsE2 (Table 1) in a final volume of 50 lL containing 2.5 units of Taq DNA polymerase (Roche Molecular Bio- chemicals, Meylan, France). The PCR fragment was inserted within the vector pGEM-T to give pWM39. The km resist- ance cassette was then inserted between the KpnI and BglII sites of the ppsE gene fragment generating a 523 bp deletion to yield pWM40. The PmeI fragment from pWM40 was then cloned within the cosmid vector pYUB854 [23]. The resulting Table 1. Oligonucleotides used in this study. Gene Oligonucleotide Sequence (5¢-to3¢) Rv2951c 2951A GCTCTAGAGTTTAAACGATCTCATTGTTGGGGCGC 2951B GCTCTAGAGTTTAAACATAGTCAATGAACTTGTACGC 2951C AGGAAGGCCGGCAAATGGC 2951D TTCACGTGAGATAAGCTCCC 2951E ACGGTTTCGGTGAAGCCAG 2951L ACAATTAATTAACAGTATGTACGAGCGATGCG 2951M ACAAAAGCTTGGCGCAAATCATAGCTTCTTG ppsE ppsE1 GACTAGTTTAAACGGATCGACGAGTTCGACGC ppsE2 GACTAGTTTAAACGAGGCACTGTGACCAGATGC ppsE3 CGTTCTGGAGCAACCTTCG ppsE4 GGTCGAGGAAGTACGTGAC res res1 GCTCTAGAGCAACCGTCCGAAATATTATAAA res2 GCTCTAGATCTCATAAAAATGTATCCTAAATCAAATATC Phthiocerol dimycocerosates in M. tuberculosis R. Sime ´ one et al. 1966 FEBS Journal 274 (2007) 1957–1969 ª 2007 The Authors Journal compilation ª 2007 FEBS [...]... after infection to determine the number of CFUs that seeded in lungs, and the remaining five mice were killed 21 days after infection to count the number of bacteria present in lungs and spleen Bacteria were recovered from the spleen and lungs by homogenizing tissues in 5 mL of NaCl ⁄ Pi containing 0.05% Tween-80, and the number of viable bacteria in the organs of infected mice were determined by plating... in a final volume of 500 lL The actual CFUs of each strain in both inocula were determined by plating serial dilutions on 7H11 plates containing either Km or Hyg before infection Ten BALB ⁄ c mice were infected intranasally [26] with 20 lL (5 · 103 CFU) of the H37Rv:pMV361H ⁄ PMM56 mixture, and 10 mice were infected with 20 lL (5 · 103 CFU) of the H37Rv:pMV361H ⁄ PMM74 mixture For each infection group,... Lederer E (1963) Biosynthesis of phthiocerol: incorporation of methionine and propionic acid Chem Ind 31, 1285–1286 10 Perez E, Constant P, Laval F, Lemassu A, Laneelle ´ MA, Daffe M & Guilhot C (2004) Molecular dissection of the role of two methyltransferases in the biosynthesis of phenolglycolipids and phthiocerol dimycoserosate in the Mycobacterium tuberculosis complex J Biol Chem 279, 42584–42592 11 Onwueme... (2002) Role of the pks15 ⁄ 1 gene in the biosynthesis of phenolglycolipids in the Mycobacterium tuberculosis complex Evidence that all strains synthesize glycosylated p-hydroxybenzoic methyl esters and that strains devoid of phenolglycolipids harbor a frameshift mutation in the pks15 ⁄ 1 gene J Biol Chem 277, 38148–38158 ´ ´ ´ 14 Daffe M, Lacave C, Laneelle MA & Laneelle G (1987) Structure of the major... was then cut with PacI and ligated with the mycobacteriophage phAE87 The ligation products were encapsidated in vitro using the Gigapack III XL kit (Stratagene, La Jolla, CA, USA), and the mix was used to infect E coli HB101, following the manufacturer’s recommendations Transfectants were selected on LB plates containing Km A recombinant phagemid containing the disrupted gene construct was selected and. .. exchange and was retained for further analysis (supplementary Fig S1B) Complementation of the M tuberculosis H37Rv Rv2951c gene-disrupted mutant Phthiocerol dimycocerosates in M tuberculosis (7.4 · 105 Bq) of sodium [1-14C]propionate (specific activity, 2.03 · 1012 BqÆmol)1; MP Biomedicals, Illkirch, France) were added to log-phase cultures of the wild-type M tuberculosis H37Rv, and the PMM74 and the PMM56... Cultures of strains H37Rv, PMM56 and PMM74 of M tuberculosis were grown to mid-logarithmic phase in 7H9 supplemented with ADC and Km when necessary, and centrifuged at 10 000 g for 10 min at room temperature using a Jouan CR412 centrifuge with T4 swing out rotor (Jouan, Saint-Herblain, France) The cell concentrations were adjusted to allow the inoculation of 10 mL cultures at a final D600 of 0.02 with... molecular mass determination of mycolic acids by MALDI-TOF mass spectrometry Anal Chem 73, 4537–4544 26 Pethe K, Alonso S, Biet F, Delogu G, Brennan MJ, Locht C & Menozzi FD (2001) The heparin-binding haemagglutinin of M tuberculosis is required for extrapulmonary dissemination Nature 412, 190–194 Supplementary material The following supplementary material is available online: Fig S1 Construction and. .. lL of bacterial suspension SDS was added to a final concentration of 0.1%, and cultures were incubated for 8 days at 37 °C Aliquots were collected after 0, 1, 4, and 8 days of growth, and the number of viable bacteria was evaluated by plating serial dilutions on 7H11 medium NMR spectroscopy Competition assays in mice For the mixed-infection experiments in mice, the M tuberculosis H37Rv wild-type strain... Dissecting the mechanism and assembly of a complex virulence mycobacterial lipid Mol Cell 17, 631–643 Rousseau C, Winter N, Pivert E, Bordat Y, Neyrolles O, Ave P, Huerre M, Gicquel B & Jackson M (2004) Production of phthiocerol dimycocerosates protects Mycobacterium tuberculosis from the cidal activity of reactive nitrogen intermediates produced by macrophages and modulates the early immune response to infection . Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and. difference between the number of CFUs of the wild-type strain and that of the PMM56 mutant strain in lungs and in the spleen (Fig. 7A). Indeed, both strains multiplied