Báo cáo khoa học: Molecular cloning of the ecdysone receptor and the retinoid X receptor from the scorpion Liocheles australasiae pot

Molecular cloning of the ecdysone receptor and the retinoid X receptor from the scorpion Liocheles australasiae Yoshiaki Nakagawa, Atsushi Sakai, Fumie Magata, Takehiko Ogura, Masahiro Miyashita and Hisashi Miyagawa Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kyoto, Japan The largest phylum in the animal kingdom, the Arthropoda, is subdivided into two subphyla – the Mandibulata and the Chelicerata; the former includes the classes Insecta and Crustacea; and the latter includes the class Arachnida, which contains the scor- pions, ticks and spiders among others. Scorpions are ancient arachnids that originated some 420 million years ago during the Silurian period (Paleozoic era). The evolutionary relationship between the various groups is shown in the form of a phylogenetic tree of Arthropoda in Fig. 1. To date, some 1600 scorpion species in 14 families have been identified and they are Keywords ecdysone receptor (EcR); Liocheles australasiae; retinoid X receptor (RXR); scorpion; ultraspiracle (USP) Correspondence Y. Nakagawa, Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kyoto 606-8502, Japan Fax: +81 75 7536123 Tel: +81 75 7536117 E-mail: naka@kais.kyoto-u.ac.jp (Received 13 June 2007, revised 9 October 2007, accepted 11 October 2007) doi:10.1111/j.1742-4658.2007.06139.x cDNAs of the ecdysone receptor and the retinoid X receptor were cloned from the Japanese scorpion Liocheles australasiae, and the amino acid sequences were deduced. The full-length cDNA sequences of the L. austra- lasiae ecdysone receptor and the L. australasiae retinoid X receptor were 2881 and 1977 bp in length, respectively, and the open reading frames encoded proteins of 560 and 414 amino acids. The amino acid sequence of the L. australasiae ecdysone receptor was similar to that of the ecdysone receptor-A of the soft tick, Ornithodoros moubata (68%) and to that of the ecdysone receptor-A1 of the lone star tick, Amblyomma americanum (66%), but showed lower similarity to the ecdysone receptors of Orthoptera and Coleoptera (53–57%). The primary sequence of the ligand-binding region of the L. australasiae ecdysone receptor was highly homologous to that of ticks (85–86%). The amino acid sequence of the L. australasiae retinoid X receptor was also homologous to the amino acid sequence of ultraspiracles of ticks (63%) and insects belonging to the orders Orthoptera and Coleop- tera (60–64%). The identity of both the L. australasiae ecdysone receptor and the L. australasiae retinoid X receptor to their lepidopteran and dip- teran orthologs was less than 50%. The cDNAs of both the L. australasiae ecdysone receptor (L. australasiae ecdysone receptor-A) and the L. austra- lasiae retinoid X receptor were successfully translated in vitro using a rabbit reticulocyte lysate system. An ecdysone analog, ponasterone A, bound to L. australasiae ecdysone receptor-A (K D ¼ 4.2 nm), but not to L. australa- siae retinoid X receptor. The L. australasiae retinoid X receptor did not enhance the binding of ponasterone A to L. australasiae ecdysone receptor- A, although L. australasiae retinoid X receptor was necessary for the bind- ing of L. australasiae ecdysone receptor-A to ecdysone response elements. Abbreviations EcR, ecdysone receptor; EcRE, ecdysone response element; 20E, 20-hydroxyecdysone; LaEcR, Liocheles australasiae ecdysone receptor; LaEcR-A, Liocheles australasiae ecdysone receptor A-isoform; LaRXR, Liocheles australasiae retinoid X receptor; PonA, ponasterone A; RXR, retinoid X receptor; USP, ultraspiracle. FEBS Journal 274 (2007) 6191–6203 ª 2007 The Authors Journal compilation ª 2007 FEBS 6191 represented around the world [1,2]. Although scorpions molt like insects and crustaceans, the hormonal regula- tion of the molting process and details of the molting mechanism are not clear. In insects, the physiology of molting and metamorphosis has been intensively stud- ied and the role of the molting hormone, 20-hydroxy- ecdysone (20E), at the molecular level has been well established. 20E is the ligand that binds to a hetero- dimeric receptor complex made up of two proteins, the ecdysone receptor (EcR) and the retinoid X receptor (RXR) homolog ultraspiracle (USP). This complex, upon binding to the ecdysone response element (EcRE), transactivates the various genes involved in the molting process [3,4]. On the other hand, in crusta- ceans, 20E has an inhibitory role, unlike its stimula- tory role in insects [5]. To date, about 30 EcRs and USPs (or RXRs) have been characterized primarily in insects, along with several in other arthropod species (http://www.ncbi.nlm.nih.gov/). It is generally thought that RXR orthologs of Lepidoptera and Diptera are USPs, although other arthropods have RXRs, based upon their sequence homologies. These USPs and RXRs have similar roles. In Orthoptera, it was shown that the RXR can be replaced with the USP of other insects [6,7]. EcRs, USPs and RXRs are members of the steroid and thyroid hormone receptor superfamily and their sequences consist of regions referred to as A ⁄ B (transactivation domain), C (DNA-binding domain), D (hinge region) and E ⁄ F (ligand- or hormone-binding domain) [8,9]. The X-ray crystal structures of the ligand-binding domains of EcR, USPs and RXRs have been resolved in a few insects [10–13], and the binding of ponasterone A (PonA) to EcR has been shown [12,13]. Previously, we determined the cDNA sequences of the EcRs and the USPs (RXRs) of Chilo suppressalis [14] and Leptinotarsa decemlineata [15]. Dissociation constants of the binding of PonA to these receptors have been determined using an in vitro translated EcR ⁄ USP (RXR) heterodimer, as well as other crude molting hormone receptor proteins [16–18]. The affin- ity of PonA for EcR is dramatically enhanced in the presence of USP [14,15]. We also measured the activity of various ecdysone agonists by measuring their bind- ing ability to in vitro translated EcR ⁄ USP heterodi- mers [14,15,19] and found that the ligand-binding affinity to the receptor is affected by the structure of EcR [20]. Therefore, the elucidation of EcR and USP (RXR) structures is important for understanding the molecular mechanism of the action of 20E. In this study, we report the cloning of cDNAs for EcR and RXR from an ancient terrestrial arachnid, the Japanese scorpion Liocheles australasiae as the ini- tial step towards understanding the molting process in this species. We also studied the binding of a molting hormone analog, PonA, to the in vitro translated receptor proteins – L. australasiae EcR (LaEcR) and L. australasiae RXR (LaRXR) – as well as to the ecdysone response element (EcRE), and the results are presented here. Results cDNA cloning of LaEcR and LaRXR A 379-bp fragment was amplified by RT-PCR using degenerate primers (Table 1) designed from the highly Arthropoda Chelicerata Arachinida Scorpiomorpha Acaromor p ha Mandibulata Insecta Crustacea Fig. 1. Phylogeny of Arthropoda. Table 1. Degenerate primers used in this study. a LaEcR LaRXR Primers for PCR F1 WSNGGNTAYCAYTAYAAYGC F1 ATHTGYGGNGAYMGNGC F2 GARGGNTGYAARGGNTTYTT F2 GGNAARCAYTAYGGNGTNTA F3 TGMGNMGNAARTGYCARGARTG F3 GATTCAGATCCCGACCATAAAGA R1 TCNSWRAADATNRCNAYNGC R1 TCYTCYTGNACNGCYTC R2 CATCATNACYTCNSWNSWNSWNGC R2 CAYTTYTGRTANCKRCARTA R3 AAYTCNACDATNARYTGNACNGT R3 GCAAGCTGGAAAAGAGTAATGTGAC Priners for 5¢-RACE RR1 AGACTCCCGTTTGATGGCACACTG RR1 ATACTGGCAGCGATTCCTTTGAC RR2 GCATTCCGACACTGAGGCACTTTT RR2 AGCCTTTACAACCTTCACAGC Primers for 3¢-RACE RF1 GAAAAAGTGCCTCAGTGTCGGAATG RF1 ATAGCTGTGAAGGTTGTAAAGG RF2 CAGTGTGCCATCAAACGGGAGTCTA RF2 GACAAACGTCAAAGGAATCG a N means a mixture of A, T, G and C. In the same way, D (A, G, T), H (A, C, T), K (G, T), M (A, C), R (A, G), S (C, G), W (A, T) and Y (C, T) means a mixture of deoxynucleoside. Molting hormone receptors of a scorpion Y. Nakagawa et al. 6192 FEBS Journal 274 (2007) 6191–6203 ª 2007 The Authors Journal compilation ª 2007 FEBS conserved regions of the DNA- and ligand-binding domains of several insect EcRs, and the nucleotide sequence was converted to an amino acid sequence. The deduced amino acid sequence from the PCR prod- uct was similar to the corresponding EcR region of ar- thropods. Subsequently, we determined the full length of the cDNA sequence by 5¢-RACE and 3¢-RACE. By combining the sequences of the PCR fragments, we were able to establish the full length of the cDNA sequence as 2861 bp. The longest ORF encoded 539 amino acids. A blast search (http://www.ncbi.nlm. nih.gov/BLAST/) showed that the deduced amino acid sequence was analogous to the EcR-A of the soft tick Ornithodoros moubata (accession number: AB191193.1) as shown in Table 2. Therefore, we decided that this sequence represented the LaEcR A-isoform (LaEcR- A). In a similar manner, we cloned the full length 1977-bp cDNA sequence, and deduced the 410-amino acid sequence from the cDNA sequence. We decided that this sequence corresponded to the LaRXR. These sequences have been submitted to DDBJ ⁄ EMBL ⁄ GenBank under the accession numbers AB297929 (LaEcR-A) and AB297930 (LaRXR). The amino acid sequence alignment indicated that this EcR polypep- tide included the entire A ⁄ B (1–187), C (188–253), D (254–317), E (318–536) and F (537–539) regions (numbers in parentheses indicate the first and last amino acids of the primary sequence of the proteins). The F-region, which exists in the Drosophila EcR and other mammalian nuclear receptors, was very small (three amino acids: IQE) in LaEcR. LaRXR is also constructed from A ⁄ B (1–87), C (88–153), D (154–182) and E (183–410) regions. The C-regions of EcRs and USPs are highly conserved. However, other regions, particularly the N-terminal parts of USP ⁄ RXR, vary. The alignments of amino acid sequences of the A ⁄ B and E regions of LaEcR-A and LaRXR with those of other arthropods are shown in Fig. 2. We compared the deduced amino acid sequences of LaEcR-A and LaRXR with those of EcRs and USPs (RXRs) from other species (Tables 2 and 3). LaEcR-A is most similar to the EcR-A of O. moubata (68%), and LaRXR is most similar to the RXR of Locusta migratoria (64%). The identity of LaRXR with RXRs of other arthropods such as Orthoptera and Coleop- tera is relatively high (> 60%), but less than 50% when compared with the USP sequences from Lepi- doptera and Diptera. Interestingly, the identity of LaRXR to the RXRa of Homo sapiens is relatively high (63%). We also compared A ⁄ B, C, D and E Table 2. Identities of amino acid sequences of EcR-A isoforms against that of LaEcR-A (%). Species Length (amino acids) Identity against LaEcR-A (%) a A ⁄ B region C region D region E region Total Ornithodoros moubata b 567 41 98 56 86 68 Amblyomma americanum c 560 38 98 50 85 66 Blattella germanica d 570 26 100 48 66 54 Locusta migratoria e 541 25 98 48 67 53 Tribolium castaneum f 549 26 100 48 68 54 Leptinotarsa decemlineata g 565 25 94 47 67 53 Tenebrio molitor h 481 27 100 47 65 57 Apis mellifera i 567 20 98 42 69 52 Aedes aegypti j 776 26 88 42 60 48 Drosophila melanogaster k 849 25 88 39 58 47 Chironomus tentans l 536 23 89 41 55 43 Manduca sexta m 568 19 89 33 54 42 Bombyx mori n 515 27 89 25 54 43 Chilo suppressalis o 518 23 89 36 54 44 a Identity values were not calculated for the F regions of EcRs because most of them are too short for sequence comparison. b Accession number AB191193.1. c Ref. [22]. d Ref. [39]. e Ref. [40]. f Accession number AM295015.1. g Ref. [15]. h Accession number AJ251542.1. i Ref. [41]. j Ref. [42]. k Ref. [43]. l Ref. [44]. m Ref. [45]. n Ref. [46]. o Ref. [33]. Table 3. Identities of amino acid sequences of USPs (RXRs) against that of LaRXR (%). Species Length (amino acids) Identity against LaRXR (%) a A ⁄ B region C region D region E region Total Amblyomma americanum b 400 20 92 75 71 63 Blattella germanica c 436 28 89 75 69 63 Locusta migratoria d 411 28 89 75 71 64 Tribolium castaneum e 407 28 91 75 64 61 Leptinotarsa decemlineata f 384 30 89 75 59 60 Tenebrio molitor g 408 28 91 75 64 61 Apis mellifera h 427 32 91 71 67 60 Aedes aegypti i 484 31 89 38 44 46 Drosophila melanogaster j 508 28 91 31 46 48 Chironomus tentans k 552 32 89 34 40 44 Manduca sexta l 461 26 91 45 43 45 Bombyx mori m 462 28 89 50 40 45 Chilo suppressalis n 410 31 92 45 43 45 Homo sapiens o 462 20 88 83 73 63 a Identity values were not calculated for the F regions of EcRs because most of them were too short for sequence comparison. b Accession number AF305213.1. c Ref. [7]. d Ref. [47]. e Ref. accession number AM295015.1. f Ref. [15]. g Ref. accession num- ber AJ251542.1. h Ref. [48]. i Ref. [49]. j Ref. [50]. k Ref. [44]. l Ref. [51]. m Ref. [52]. n Ref. [21]. o Ref. [53]. Y. Nakagawa et al. Molting hormone receptors of a scorpion FEBS Journal 274 (2007) 6191–6203 ª 2007 The Authors Journal compilation ª 2007 FEBS 6193 regions of EcRs and USPs (RXRs) among several spe- cies. It showed that the C region of EcRs is highly conserved among all species (89–100%), but the amino acid sequences of E regions varied among the species. The sequence of the E region of LaEcR-A is highly analogous to that of O. moubata EcR (OmEcR; 86%) 51 167 223 119 132 42 62 39 78 55 74 77 3 52 120 79 28 10 10 10 125 134 114 141 113 122 53 56 51 49 158 234 290 186 198 187 196 178 207 179 187 117 114 115 112 L. australasiae EcR-A O. moubata EcR-A A. americanum EcR-A1 B. germanica EcR-A L. migratoria EcR-A T. castaneaum EcR-A L. decemlineata EcR-A T. molitor EcR-A A. mellifera EcR-A A. aegypti EcR-A D. meelanogaster EcR-A C. tentans EcR-A M. sexta EcR-A B. mori EcR-A C. suppressalis EcR-A L. australasiae EcR-A O. moubata EcR-A A. americanum EcR-A1 B. germanica EcR-A L. migratoria EcR-A T. castaneaum EcR-A L. decemlineata EcR-A T. molitor EcR-A A. mellifera EcR-A A. aegypti EcR-A D. meelanogaster EcR-A C. tentans EcR-A M. sexta EcR-A B. mori EcR-A C. suppressalis EcR-A L. australasiae EcR-A O. moubata EcR-A A. americanum EcR-A1 B. germanica EcR-A L. migratoria EcR-A T. castaneaum EcR-A L. decemlineata EcR-A T. molitor EcR-A A. mellifera EcR-A A. aegypti EcR-A D. meelanogaster EcR-A C. tentans EcR-A M. sexta EcR-A B. mori EcR-A C. suppressalis EcR-A A 435 463 456 465 436 442 458 374 462 566 518 407 436 391 395 L. australasiae EcR-A O. moubata EcR-A A. americanum EcR-A1 B. germanica EcR-A L. migratoria EcR-A T. castaneaum EcR-A L. decemlineata EcR-A T. molitor EcR-A A. mellifera EcR-A A. aegypti EcR-A D. meelanogaster EcR-A C. tentans EcR-A M. sexta EcR-A B. mori EcR-A C. suppressalis EcR-A B 535 563 556 565 536 543 559 475 562 670 622 511 540 495 499 L. australasiae EcR-A O. moubata EcR-A A. americanum EcR-A1 B. germanica EcR-A L. migratoria EcR-A T. castaneaum EcR-A L. decemlineata EcR-A T. molitor EcR-A A. mellifera EcR-A A. aegypti EcR-A D. meelanogaster EcR-A C. tentans EcR-A M. sexta EcR-A B. mori EcR-A C. suppressalis EcR-A Fig. 2. Alignment of the primary sequences of (A) A ⁄ B regions of EcRs, (B) E regions of EcRs, (C) A ⁄ B regions of USPs and RXRs, and (D) E regions of USPs and RXRs. Alignments were performed using the CLC FREE WORKBENCH 4.0.1 (CLC bio A ⁄ S). In the alignment figure (C) the amino acid residues that correspond to those important for the binding of PonA to the EcR of H. virescens are boxed. The arrow head indi- cates the 396th amino acid of LaEcR-A, which is unique to LaEcR-A. Molting hormone receptors of a scorpion Y. Nakagawa et al. 6194 FEBS Journal 274 (2007) 6191–6203 ª 2007 The Authors Journal compilation ª 2007 FEBS and Amblyomma americunum EcR (AmaEcR; 85%), and moderately analogous to those of Orthoptera and Coleoptera (65–69%). The identity of the A ⁄ B regions of EcRs and USPs (RXRs) are not as high as the iden- tity for the C and E regions (< 41%). In vitro translation of LaEcR-A and LaRXR LaEcR-A and LaRXR were translated using an in vitro transcription ⁄ translation kit (rabbit reticulocyte lysate), with 35 S-labelled methionine ([ 35 S]Met), and L. australasiae RXR H. sapiens RXR C. suppressalis USP B. mori USP M. sexta USP1 C. tentans USP D. melanogaster USP A. aegypti USP-A1 A. mellifera RXR T. moritor RXR L. decemlineata RXR T. castaneum RXR L. migratoria RXR B. germanica RXR1 A. americanum RXR1 52 50 55 51 48 31 44 73 80 48 118 76 77 76 23 L. australasiae RXR H. sapiens RXR C. suppressalis USP B. mori USP M. sexta USP1 C. tentans USP D. melanogaster USP A. aegypti USP-A1 A. mellifera RXR T. moritor RXR L. decemlineata RXR T. castaneum RXR L. migratoria RXR B. germanica RXR1 A. americanum RXR1 87 79 94 87 85 67 86 109 137 103 196 112 113 137 59 C L. australasiae RXR H. sapiens RXR C. suppressalis USP B. mori USP M. sexta USP1 C. tentans USP D. melanogaster USP A. aegypti USP-A1 A. mellifera RXR T. moritor RXR L. decemlineata RXR T. castaneum RXR L. migratoria RXR B. germanica RXR1 A. americanum RXR1 268 258 292 268 264 241 265 284 333 339 401 304 305 251 318 L. australasiae RXR H. sapiens RXR C. suppressalis USP B. mori USP M. sexta USP1 C. tentans USP D. melanogaster USP A. aegypti USP-A1 A. mellifera RXR T. moritor RXR L. decemlineata RXR T. castaneum RXR L. migratoria RXR B. germanica RXR1 A. americanum RXR1 369 358 393 369 365 342 363 385 444 459 512 413 414 361 419 D L. australasiae RXR H. sapiens RXR C. suppressalis USP B. mori USP M. sexta USP1 C. tentans USP D. melanogaster USP A. aegypti USP-A1 A. mellifera RXR T. moritor RXR L. decemlineata RXR T. castaneum RXR L. migratoria RXR B. germanica RXR1 A. americanum RXR1 410 400 436 411 407 384 408 427 484 508 552 461 462 410 462 Fig. 2. (Continued). Y. Nakagawa et al. Molting hormone receptors of a scorpion FEBS Journal 274 (2007) 6191–6203 ª 2007 The Authors Journal compilation ª 2007 FEBS 6195 subjected to SDS ⁄ PAGE (Fig. 3). The molecular masses of LaEcR-A and LaRXR were estimated to be 63 and 51 kDa, respectively, from the band shifts in electrophoresis, and they were consistent with the values (60.8 kDa for LaEcR-A and 46.3 kDa for LaRXR) calculated from the amino acid sequences. The extra bands of lower molecular mass are probably degradation products of the full-length proteins. Specific binding of PonA to an in vitro translated protein We measured the binding affinity of ligands for the in vitro translated receptor proteins (LaEcR-A and LaRXR) using 3 H-labelled ponasterone A ([ 3 H] PonA). The specific binding of in vitro-translated LaEcR-A and LaEcR-A ⁄ LaRXR proteins to PonA was calculated as the difference between the total binding and nonspecific binding, as previously reported [14,15]. As shown in Fig. 4, PonA bound to LaEcR-A, but not to LaRXR. The specific binding of LaEcR-A was not increased in the presence of LaRXR. These results are in contrast to the insect receptors where the specific binding of PonA to EcR was markedly increased in the presence of USP (RXR) [14,15]. In further experiments, the dissociation equilibrium constant, K D , for the binding of PonA to LaEcR-A alone and to the LaEcR-A ⁄ LaRXR heterodimer, was calculated from the saturation curve of specific binding using a nonlinear model (Fig. 5). The K D values of LaEcR-A and LaEcR-A ⁄ LaRXR were determined to be 4.2 and 3.2 nm, respectively, and the difference between these K D values was not significant. Gel mobility shift assay of LaEcR and LaRXR Binding of LaEcR-A and LaRXR to EcRE was tested by the gel mobility shift assay. We had previously shown that EcR ⁄ USP (RXR) bound to pal1 and hsp27 EcRE [15,21]. We also found in this study that the LaEcR-A ⁄ LaRXR heterodimer bound to these seq- uences, as shown in Fig. 6. LaEcR-A alone did not bind to pal1 and hsp27 in the absence of LaRXR. PonA did not significantly affect the binding of the LaEcR-A ⁄ LaRXR heterodimer or of LaEcR-A alone to both pal1 and hsp27. LaRXR alone did not bind to pal1 and hsp27. Our results are similar to those reported for L. decemlineata EcR (LdEcR) ⁄ L. decemlineata USP (LdUSP) [15]. Discussion We have successfully cloned cDNAs for EcR-A and RXR from L. australasiae using a PCR protocol that we had standardized for our earlier studies [14,15]. Deduced amino acid sequences of EcR and RXR of L. australasiae were homologous to those from ticks that are also arachnids and a member of the subphylum Chelicerata (Fig. 1). Even though three EcR isoforms [22] and two USP (RXR) isoforms [23] were found for A. americanum, only a single pair of cDNAs for EcR and RXR could be amplified in L. australasiae by using our method. We could not isolate LaEcR B-isoforms LaEcR-A LaRXR 148kDa 98kDa 64kDa Free [ 35 S] methonine 36kDa LaRXR 51kDa LaEcR-A 63kDa 50kDa 22kDa Fig. 3. SDS ⁄ PAGE of in vitro translated LaEcR-A and LaRXR pro- teins. pET-23a(+) vector (lane1), LaEcR (lane 2), LaRXR (lane 3) and LaEcR ⁄ LaRXR (lane 4) were incubated with [ 35 S]Met. The + and ) signs indicate the presence and absence, respectively, of corre- sponding proteins. In vitro translation of proteins was conducted using a TNT T7 Quick Coupled Transcription ⁄ Translation System (Promega), according to the manufacturer’s protocol. 6000 [ 3 H] PonA binding (dpm) 4000 2000 0 NNNTTT − LaEcR-A LaRXR − Fig. 4. Binding of ponasterone A to the in vitro-translated LaEcR-A and LaRXR. The radioactivity of the precipitate collected in the filter was measured using a liquid scintillation counter. In vitro-translated LaEcR-A and LaRXR were incubated with [ 3 H]PonA in the presence or absence of excess unlabeled PonA. T, total binding; N, nonspe- cific binding; + and – indicate the presence and absence, respec- tively, of corresponding proteins. The vertical bars show the standard deviation of three replicates. Molting hormone receptors of a scorpion Y. Nakagawa et al. 6196 FEBS Journal 274 (2007) 6191–6203 ª 2007 The Authors Journal compilation ª 2007 FEBS from L. australasiae. It is well known that amino acid sequences of the A ⁄ B region from EcRs and USPs (RXRs) are diverse. However, sequences of A ⁄ B regions from EcR-As were relatively conserved among species in the same order (Fig. 2A). The A ⁄ B region of nuclear receptors is thought to be the transactivation domain. There may be a specific transactivation system that is common in the same taxonomic order of arthropods. The A ⁄ B regions of USPs (RXRs) were moderately sim- ilar among insects, as shown in Fig. 2C. Because the A ⁄ B regions of USPs (RXRs) are shorter than those of EcRs, it appears that the sequence similarity among A ⁄ B regions of all insect USPs (RXRs) is higher than that of EcRs (Fig. 2A,C). However, the identity among RXR A ⁄ B regions is low, except in the C-terminal area (Fig. 2C). In mammalian RXRs, AF-1 ligand-indepen- dent activation of transcription activity mediated by the A ⁄ B region through its phosphorylation was reported [24,25]. It is known that some protein kinases have pro- line-directed function. Therefore, it is interesting that the amino acid residues at the regions of USPs (RXRs) showing identity are prolines. We also compared the amino acid sequences of the E region of EcR-As (Fig. 2B), and those of USPs and RXRs (Fig. 2D). The E regions of EcRs were consider- ably conserved among all species. This suggests that the EcR ⁄ USP (RXR) system regulates the development of L. australasiae with 20E. On the other hand, the USP (RXR) sequences were diverse compared with EcR sequences, although some parts of the sequence were conserved. The E regions of nuclear receptors are also thought to be involved in transactivation. The con- served sequences among the E regions of USPs (RXRs) may be related to regulation of the transcription. The similarity of LaEcR-A and LaRXR with other EcRs and USPs (or RXRs) were compared (Table 2). The identity of LaEcR-A and LaRXR to those of archinids was highest, followed by those to Orthoptera (Blattodea) and Coleoptera, as well as Crustacea. The C-region sequences of 14 EcRs were also highly con- served among several species, as shown in Table 2. In the C region, there are two zinc finger regions contain- ing a P-box and a D-box, which are important for DNA recognition [26]. The P-box of LaEcR is 100% identical to that of other EcRs as well as USPs (RXRs). The D-box is 100% identical to that of crabs, ticks and orthopteran insects, and is also highly homologous to that of Coleoptera (100% to Tenebrio molitor, 80% to L. decemlineata). However, it shows only 40% identity with the D-boxes of Lepidoptera and Diptera. Ortho- ptera is geologically one of the oldest orders in Insecta, LaEcR-A/LaRXR 02030 Concentration (nM) K D = 3.2 nM LaEcR-A K D = 4.2 nM [ 3 H] PonA binding (dpm) [ 3 H] PonA binding (dpm) 0 1000 2000 3000 4000 0 10 20 30 3000 2000 1000 0 Concentration (nM) AB Fig. 5. The affinity of PonA for (A) LaEcR-A and (B) LaEcR-A ⁄ LaRXR. In vitro translated proteins were incubated with various concentrations of [ 3 H]PonA. Specific binding was determined at the various [ 3 H]PonA concentrations to derive the curves as the difference of the radioactiv- ity in the presence and absence of nonradioactive PonA (10 l M). The K D values of PonA to LaEcR-A alone and to LaEcR-A ⁄ LaRXR hetero- dimer were evaluated by nonlinear regression using PRISM software (Graphpad Software Inc.). hsp27 pal1 LaEcR-A LaRXR PonA pET-23a(+) ++ - - - + - - + - - - + + + - - + + + - - ++ - - - + + - - - + + + - - + + + - - Bound Free probe Fig. 6. Binding of LaEcR-A and LaEcR-A ⁄ LaUSP to the ecdysone response element (EcRE). In vitro translated proteins were incubated with 32 P-labelled hsp27 or pal1 and then analyzed on a nondenaturating polyacrylamide gel. Y. Nakagawa et al. Molting hormone receptors of a scorpion FEBS Journal 274 (2007) 6191–6203 ª 2007 The Authors Journal compilation ª 2007 FEBS 6197 originating in the Carboniferous period (Paleozoic era) and Coleoptera appeared later in the lower Permian period (Paleozoic era). Diptera appeared still later in the Permian period, while Lepidoptera appeared even later than that, during the Jurassic period (Mesozoic era). The result obtained in this study is consistent with the phylogenetic relationship. The E region of LaEcR-A is most similar to that of OmEcR (86%). Although the E region of LaEcR-A is very similar to those of insect EcR-As, the similarity of LaEcR-A to archnid EcR-A is definitely high, as shown in Table 2. It is thought that the E-region sequence is very important in determining the binding affinity of EcR to ligand molecules [19]. Therefore, the difference of EcR E-region structures between arachnid and insect is related to the recognition of the structure of ligand molecule by EcRs. LaEcR-A may have unique ligand selectivity compared with insect EcRs. As shown in Fig. 6, LaEcR-A alone binds strongly to PonA, and LaRXR does not enhance the binding. This is different from the case of EcRs and USPs (RXRs) of insects, and such a unique characteristic may be dependent on the E-region structure of LaEcR-A. Because the nuclear receptor proteins are often used as the gene switch, the ligand-binding affinity of LaEcR-A, which is not enhanced by LaRXR, is expected to be interesting. Ecdysone and its agonists, together with their receptors, are present only in arthropods and are relatively nontoxic to plants and mammals. Also, plant steroid hormones, such as bras- sinolide and castasterone, and the mammalian steroi- dal hormone, estradiol, do not bind to ecdysone receptor [27,28]. Therefore, the ecdysone–receptor complex can be safely used for studying various aspects of genetic engineering in plants and mam- mals [4]. For example, the Choristoneura fumiferna EcR (CfEcR) ⁄ Locusta migratoria RXR (LmRXR) cas- sette, together with luciferase as a reporter gene placed under the GAL4 response element and the )46 34S minimal promoter, was successfully turned on by an ecdysone agonist, resulting in the expression of the luciferase gene in plants and protoplasts [29]. Further- more, this cassette regulated the expression of a Super- man-like single zinc finger protein 11 (ZFP11) in both Arabidopsis and transgenic tobacco plants [30]. In addition, the EcR gene switch was successfully tested in a mammalian cell system [31]. The unique character- istics of LaEcR-A and LaRXR may precisely control gene regulation and contribute to various studies such as functional genomics, gene therapy, therapeutic pro- tein production and tissue engineering. Although LaRXR is required for the strong binding of LaEcR-A to EcRE, it has no effect on the binding of PonA to LaEcR-A. Because the main role of recep- tors is to activate the particular gene responding to the ligand binding, it is generally thought that the hetero- dimerization of receptor proteins is required for the ligand binding. However, this study indicates that the heterodimerization between USP (RXR) and EcR may be more important for the DNA binding than for ligand binding. The taxonomic similarity among different species of arthropods was examined by constructing phylogenetic trees using clc free workbench 4.0.1 (CLC bio A ⁄ S, Aarhus, Denmark) for full-length sequences of EcR and USP (RXR) (Fig. 7). EcR and RXR of scorpions are similar to those of crabs and ticks, and are placed in a different group separate from the insects. The ‘USP’ of L. australasiae was deduced from a PCR product obtained using degenerate primers designed on the basis of the C region of insect USPs, but it turned out to be closer to RXR and not USP. Therefore, it was designated as LaRXR. Interestingly, human RXR is also highly homologous to LaRXR (63%). Because it is known that mammalian RXRs have a couple of functions, LaRXR may work alone rather than in a EcR ⁄ RXR heterodimer system. Previously, we reported the specific binding of PonA to in vitro translated EcR and EcR ⁄ USP heterodimers of a lepidopteran C. suppressalis [14] and a coleopteran L. decemlineata [15]. In these species, the specific bind- ing of PonA to EcR was significantly enhanced in the presence of USP. The heterodimerizing effect of USP on ligand–receptor binding is common to the EcR ⁄ USP heterodimers of insects. However, as reported in this study, the binding of PonA to LaEcR- A is not affected by the addition of LaRXR in L. aus- tralasiae. The K D value (4.2 nm) for the binding of PonA to LaEcR-A is comparable to that for the binding of EcR ⁄ USP heterodimers such as C. suppres- salis EcR (CsEcR) ⁄ C. suppressalis USP (CsUSP) (K D 1.2 nm) [14], L. decemlineata (LdEcR) ⁄ L. decemlineata (LdUSP) (K D 2.8 nm) [32], and D. melanogaster EcR (DmEcR) ⁄ D. melanogaster USP (DmUSP) (K D 0.85 nm) [15]. The K D values for the binding of PonA to CsEcR alone and to LdEcR alone were 55 and 73 nm, respectively, which are significantly larger (lower affinity) than for LaEcR alone. Recently, an X-ray crystal structure of the EcR ligand-binding domain ⁄ USP ligand-binding domain of Heliothis vires- cens with PonA was solved. In the analysis of the EcR ⁄ ligand-binding domain ⁄ PonA complex, amino acid residues of H. virescens EcR (HvEcR), which are important for the binding with PonA, were shown. Most of these residues were conserved in LaEcR-A, with the exception of 396T of LaEcR-A (Fig. 2). The Molting hormone receptors of a scorpion Y. Nakagawa et al. 6198 FEBS Journal 274 (2007) 6191–6203 ª 2007 The Authors Journal compilation ª 2007 FEBS corresponding residues of other EcR-As were lipo- philic. This difference may affect the strong binding affinity of LaEcR-A alone to PonA. Even though EcR and USP have been characterized in a tick, A. americanum, the molting mechanism in the subphylum Chelicerata, which includes the scorpi- ons, ticks and spiders, is not completely understood. The presence of EcR and USP homologs in scorpions suggests that the molting is regulated by ecdysteroids. Unlike insects there is no cooperative interaction A. mellifera EcR-A M. sexta EcR-A P. megacephala EcR-A T. castaneum EcR-A L. migratoria EcR-A B. germanica EcR-A L. decemlineata EcR-A T. molitor EcR-A B. mori EcR-A A. aegypti EcR-A C. suppressalis EcR-A L. australasiae EcR-A A. americanum EcR-A1 O. moubata EcR-A D. magna EcR-A1 D. melanogaster EcR-A C. tentans EcR-A 100 100 100 100 100 99 82 100 100 100 100 90 90 63 100 L. australasiae RXR A. americanum RXR1 M. musculus RXRα1 D. magna RXR A. mellifera RXR B. mori USP M. sexta USP1 D. melanogaster USP S. depilis RXR T. castaneum RXR A. aegypti USP-A1 L. migratoria RXR B. germanica RXR1 L. decemlineata RXR 100 C. pugilator RXR G. latera lis RXRα H. sapiens RXRα Xenos pecki RXR 100 100 95 100 100 100 100 100 66 71 31 19 53 C. suppressalis USP T. molitor RXR 100 100 100 99 C. tentans USP A B Fig. 7. Phylogenetic tree constructed using the primary sequences of (A) EcRs and (B) USPs (RXRs). References for sequences are shown in Tables 2 and 3 unless noted otherwise. Other EcRs and RXRs were obtained either from references or from the NCBI website. EcR-A of Pheidole megacephala (AB194765.1); EcR-A1 of Daphnia magna (AB274820.1); RXR of Xenos pecki [34], Daphnia magna [35], Celuca pugila- tor [36] and Gecarcinus lateralis [37]; and RXRa1ofMus musculus [38] and Scaptotrigona depilis (DQ190542.1). Unrooted neighbour-joining (NJ) trees were prepared using CLC Free Workbench 4.0.1 (CLC bio A ⁄ S). A bootstrap value is attached to each branch, and the value is a measure of the confidence in this branch. The number of replicates in the bootstrap analysis is adjusted to 100. Y. Nakagawa et al. Molting hormone receptors of a scorpion FEBS Journal 274 (2007) 6191–6203 ª 2007 The Authors Journal compilation ª 2007 FEBS 6199 between EcR and RXR in terms of binding to PonA in L. australasiae, although LaRXR is needed for the binding of LaEcR-A to EcRE. If LaEcR-A functions alone as a receptor protein, another appropriate EcRE, different from pal1 and hsp27, may be required for the binding of LaEcR-A. In conclusion, cDNAs of EcR and RXR were success- fully cloned from the Japanese scorpion L. australasiae and the deduced amino acid sequences were similar to their counterparts in the tick A. americanum. Among insect species, orthopteran insects such as L. migratoria and Blattella germanica were more similar to L. austra- lasiae, in terms of molting hormone receptor proteins, than lepidopteran and dipteran insects, which are phylo- genetically younger. An ecdysone agonist, PonA, specifi- cally bound to the in vitro translated LaEcR-A alone with high affinity, and this PonA ⁄ LaEcR-A binding was not enhanced in the presence of RXR. The dissociation constant, K D , for the binding of PonA to LaEcR-A was determined to be 4.2 nm, which was similar to that for insect EcR ⁄ RXR(USP) heterodimers. Experimental procedures Chemicals Tritiated PonA ([ 3 H]PonA, 150 CiÆmmol )1 ) was purchased from American Radiolabeled Chemicals Inc. (St Louis, MO, USA). PonA was from Invitrogen Corp. (Carlsbad, CA, USA). Isolation of RNA from L. australasiae The scorpions, L. australasiae, were collected on Ishigaki Island located at the southern end of the Ryukyu island chain in Japan. A scorpion whole body (0.37 g) was frozen in liquid nitrogen and transferred to a glass homogenizer, then homogenized in 0.5 mL of TRIzolÒ (Gibco BRL, Grand Island, NY, USA). Total RNA was isolated using an acid guanidinium thiocyanate ⁄ phenol ⁄ chloroform method described previously [14,15]. The concentrations and purity of RNA were determined by spectrophotometry. Poly (A)-rich RNA was purified from the total RNA using an mRNA Purification Kit (Amersham Bioscience Corp., Piscataway, NJ, USA) for the RACE method. The concen- tration of RNA was determined using a UV spectrometer. Reverse transcription cDNA was synthesized from total RNA by RT, using a ReadyÆToÆGo TM T-Primed First-Strand Kit (Amersham Bioscience Corp.). A total RNA solution (3 lL) prepared from a whole scorpion was added and incubated for 10 min at 65 °C, then immediately cooled on ice. This RNA solu- tion was added to the ReadyÆToÆGo TM T-Primed First- Strand Kit, which was prewarmed to 37 °C, and incubated for 5 min at 37 °C. After mixing gently with a pipette, the reaction mixture was incubated for 60 min at 37 °Cto obtain the first-strand cDNA. PCR using degenerate primers The first-strand cDNA prepared from RNA was amplified by PCR using the degenerate primers listed in Table 1. Three forward and three reverse degenerate primers were designed for LaEcR based on amino acid sequences con- served in the C and E regions of other EcRs (Table 3) and are identical to those used for cDNA cloning of the EcR of L. decemlineata [15]. The first PCR was performed using EcR-F1 and EcR-R1 (94 °C ⁄ 2 min; 35 cycles of 92 °C ⁄ 1 min, 48 °C ⁄ 1 min, 72 °C ⁄ 1 min; and 72 °C ⁄ 10 min). To conduct the second and third PCRs (nested PCR), EcR-F2 ⁄ R2 and EcR-F3 ⁄ R3 were used for PCR at 52 °C and 46 °C, instead of 48 °C, for annealing. The presence of the cDNA product was resolved by agarose gel electropho- resis. Other PCR protocols used are identical to those we previously reported [15,21,33]. The degenerate primers RXR-F1 and RXR-R1 (Table 1) were used for the first PCR of cDNA of RXR, and the RXR-F2 and RXR-R1 primers were used for the second PCR (nested PCR). To confirm unidentified sequences of the 3¢-terminus after the stop codon, we performed another PCR by designing new primers (RXR-F3 and RXR-R3). The annealing tempera- ture was set as 48 °C and 46 °C, respectively. RACE Poly (A)-rich RNA was subjected to 5¢- and 3¢-RACE with a SMART TM RACE cDNA amplification kit (Clontech, Palo Alto, CA, USA). For both EcR and RXR, two reverse primers for 5¢-RACE, and two forward primers for 3¢-RACE, were designed (Table 1). The 5¢-RACE for EcR was performed by PCR with the primer EcR-RR1, and the 3¢-RACE for EcR was performed with the primer EcR-RF1, according to the manufacturer’s instructions. Both the 5¢-RACE and the 3¢-RACE were followed by a nested PCR using EcR-RR2 (annealing temperature: 66 °C) and EcR-RF2 (66 °C) primers, respectively. In the same way, the 5¢-RACE for RXR was executed with RXR-RR1, and the 3¢-RACE for RXR was executed with RXR-RF1. Each RACE reaction was followed by a nested PCR using RXR-RR2 (68 °C) and RXR-RF2 (68 °C), respectively. DNA sequencing and sequence analysis PCR products were purified by agarose gel electrophoresis and cloned into the pGEM-T Easy vector (Promega, Molting hormone receptors of a scorpion Y. Nakagawa et al. 6200 FEBS Journal 274 (2007) 6191–6203 ª 2007 The Authors Journal compilation ª 2007 FEBS [...]... 215, 213–219 35 Wang YH, Wang G & LeBlanc GA (2007) Cloning and characterization of the retinoid X receptor from a primitive crustacean Daphnia magna Gen Comp Endocrinol 150, 309–318 36 Chung AC-K, Durica DS, Clifton SW, Roe BA & Hopkins PM (1998) Cloning of crustacean ecdysteroid receptor and retinoid- X receptor gene homologs and elevation of retinoid- X receptor mRNA by retinoic acid Mol Cell Endocrinol... (2007) Effects of the structures of ecdysone receptor (EcR) and ultraspiracle (USP) on the ligand-binding activity of the EcR ⁄ USP heterodimer J Pestic Sci 32, 379–384 21 Minakuchi C, Nakagawa Y, Kiuchi M, Seino A, Tomita S & Kamimura M (2003) Molecular cloning and expression analysis of ultraspiracle (USP) from the rice stem borer Chilo suppressalis Insect Biochem Mol Biol 33, 41–49 22 Guo X, Harmon MA,... (2002) Differential expression and regulation by 20-hydroxyecdysone of mosquito ecdysteroid receptor isoforms A and B Mol Cell Endocrinol 196, 29–42 43 Koelle MR, Talbot WS, Segraves WA, Bender MT, Cherbas P & Hogness DS (1991) The Drosophila EcR gene encodes an ecdysone receptor, a new member of the steroid receptor superfamily Cell 67, 59–77 Molting hormone receptors of a scorpion 44 Imhof MO, Rusconi... the product of the Drosophila ultraspiracle locus and the vertebrate retinoid X receptor Nature 347, 298–301 51 Jindra M, Huang JY, Malone F, Asahina M & Riddiford LM (1997) Identification and mRNA developmental profiles of two ultraspiracle isoforms in the epidermis and wings of Manduca sexta Insect Mol Biol 6, 41–53 52 Tzertzinis G, Malecki A & Kafatos FC (1994) BmCF1, a Bombyx mori RXR-type receptor. .. genes, RXR and E75, in the tropical land crab, Gecarcinus lateralis: differential tissue expression of multiple RXR isoforms generated at three alternative splicing sites in the hinge and ligand-binding domains Mol Cell Endocrinol 242, 80–95 38 Chan LS & Wells RA (2007) Manipulation of reciprocal salt bridges at the heterodimerization interface alters the dimerization properties of mouse RXRalpha and PPARgamma1... Belles X & Martin D (2006) Functions of the ecdysone receptor isoform-A in the hemimetabolous insect Blattella germanica revealed by systemic RNAi in vivo Dev Biol 297, 158–171 40 Saleh DS, Zhang J, Wyatt GR & Walker VK (1998) Cloning and characterization of an ecdysone receptor cDNA from Locusta migratoria Mol Cell Endocrinol 143, 91–99 41 (2006) Insights into social insects from the genome of the honeybee... Isolation of a functional ecdysteroid receptor homologue from the ixodid tick Amblyomma americanum (L.) Insect Biochem Mol Biol 27, 945–962 23 Guo X, Xu Q, Harmon MA, Jin X, Laudet V, Mangelsdorf DJ & Palmer MJ (1998) Isolation of two functional retinoid X receptor subtypes from the Ixodid tick, Amblyomma americanum (L.) Mol Cell Endocrinol 139, 45–60 24 Dowhan DH & Muscat GEO (1996) Characterization of the. .. X- ray structure of a hemipteran ecdysone receptor ligand-binding domain: comparison with a lepidopteran ecdysone receptor ligand-binding domain and implications for insecticide design J Biol Chem 280, 22258–22269 Minakuchi C, Nakagawa Y, Kamimura M & Miyagawa H (2003) Binding affinity of nonsteroidal ecdysone agonists against the ecdysone receptor complex determines the strength of their molting hormonal... 33 Minakuchi C, Nakagawa Y, Kiuchi M, Tomita S & Kamimura M (2002) Molecular cloning, expression analysis and functional confirmation of two ecdysone receptor isoforms from the rice stem borer Chilo suppressalis Insect Biochem Mol Biol 32, 999–1008 34 Hayward DC, Trueman JW, Bastiani MJ & Ball EE (2005) The structure of the USP ⁄ RXR of Xenos pecki indicates that Strepsiptera are not closely related to... M (1993) Cloning of a Chironomus tentans cDNA encoding a protein (cEcRH) homologous to the Drosophila melanogaster ecdysteroid receptor (dEcR) Insect Biochem Mol Biol 23, 115–124 45 Jindra M, Malone F, Hiruma K & Riddiford LM (1996) Developmental profiles and ecdysteroid regulation of the mRNAs for two ecdysone receptor isoforms in the epidermis and wings of the tobacco hornworm, Manduca sexta Dev Biol . sequence of the L. australasiae ecdysone receptor was similar to that of the ecdysone receptor- A of the soft tick, Ornithodoros moubata (68%) and to that of the ecdysone receptor- A1 of the lone. the ecdysone receptor and the retinoid X receptor were cloned from the Japanese scorpion Liocheles australasiae, and the amino acid sequences were deduced. The full-length cDNA sequences of the. Molecular cloning of the ecdysone receptor and the retinoid X receptor from the scorpion Liocheles australasiae Yoshiaki Nakagawa, Atsushi Sakai,