treatment of a young single mother with psoriasis and generalized anxiety disorder
báo cáo khoa học: "Successful treatment of a T4 lung tumor with vertebral body invasion using fiducial markers in the thoracic spine for image-guided radiation therapy: A case report" pps
... Shirato H, Harada T, Harabayashi T, Hida K, Endo H, Kitamura K, Onimaru R, Yamazaki K, Kurauchi N, Shimizu T, Shinohara N, Matsushita M, DosakaAkita H, Miyasaka K: Feasibility of insertion/implantation ... data, and performed literature review JH performed the implantation of the fiducial markers LJS analyzed and interpreted the patient data and conducted the literature review All authors read and ... megavoltage (MV) images and allow for matching of patient anatomy to bony landmarks on a DRR Yin et al [8] at Henry Ford Hospital have used KV X-ray imaging with anatomy matching to vertebral bodies...
- 5
- 279
- 0
Báo cáo y học: "The short-term safety and efficacy of fluoxetine in depressed adolescents with alcohol and cannabis use disorders: a pilot randomized placebo-controlled trial" potx
... hypothesis was that treatment with fluoxetine would be associated with a favorable safety and tolerability profile As the improvement of adolescents with cannabis abuse disorders may be the result of ... interval is greater than zero, this indicates a 95% or greater probability that the mean change associated with fluoxetine treatment is greater than the mean change associated with placebo dGeneralized ... that Brent et al [13] found that having a mood disorder and a substance use disorder may put adolescents at a substantial increased risk for suicide For these reasons, safe and effective treatments...
- 13
- 380
- 0
Báo cáo khoa học: "Surgical treatment of a rare primary renal carcinoid tumor with liver metastasis" docx
... with advanced disease Response rate has been variable and may correlate to octreotide scan, but stabilization of disease has been seen in 36 to 70% of patients, with a mean duration of 12 months ... tumor of the ovary; a total abdominal hysterectomy with bilateral salpingo-oophorectomy was performed This was followed by a radical right nephrectomy with lymphadenectomy and a formal left hepatectomy ... year after her initial surgery, with no evidence of tumor recurrence Case presentation We evaluated a 45 year-old patient who presented initially with abdominal pain Abdominal and pelvic CT scan...
- 4
- 329
- 0
Báo cáo y học: "Heel raises versus prefabricated orthoses in the treatment of posterior heel pain associated with calcaneal apophysitis (Sever’s Disease): study protocol for a randomised controlled trial" ppt
... reliable data being available regarding calcaneal apophysitis causation and no clinical trial comparing treatment approaches, no clinical treatment path can be determined as “best practice” [19], therefore ... deviation and weight standard deviation, will be collected for all participants at the baseline assessment along with the Foot Posture Index-6 (FPI-6), a clinical standardised measure of a participant’s ... World Health Organization, Regional Office for Europe, Copenhagen, DANEMARK 2003 Kavanagh AM, Goller JL, King T, Jolley D, Crawford D, Turrell G: Urban area disadvantage and physical activity: a multilevel...
- 7
- 516
- 0
báo cáo khoa học: "Successful treatment of a free-moving abdominal mass with radiation therapy guided by conebeam computed tomography: a case report" potx
... part of vertebral body S2 Disease was evident in the mediastinum and right pleural area but was not causing any symptoms at that time, and the decision was made to administer palliative radiation ... Cite this article as: Dabaja et al.: Successful treatment of a free-moving abdominal mass with radiation therapy guided by cone-beam computed tomography: a case report Journal of Medical Case Reports ... analyzed and interpreted the patient data regarding the radiation treatment MRS analyzed the technical data, particularly use of the conebeam CT PH helped obtain consent and provided patient care...
- 4
- 375
- 0
báo cáo khoa học: "Development of a duodenal gallstone ileus with gastric outlet obstruction (Bouveret syndrome) four months after successful treatment of symptomatic gallstone disease with cholecystitis and cholangitis: a case report" pps
... the day of admission revealed a normal pancreatic duct and a small pigmented gallstone of the CBD that was extracted with an extraction balloon after endoscopic Page of Table Laboratory data for ... count of 14.3 cells/nL, an elevated C-reactive protein (CRP) level of 25.9 mg/dL, mildly elevated plasma aspartate aminotransferase and alanine aminotransferase (AST and ALT) levels of 51 U/L and ... on a CT scan and because we were planning a one-stage surgery, we performed a laparotomy instead of choosing a laparoscopic approach Conclusion In a patient with gallstone disease with abdominal...
- 5
- 272
- 0
báo cáo khoa học: " Successful treatment of metastatic hepatic epithelioid hemangioendothelioma with thalidomide: a case report" potx
... pulmonary, hepatic and retroperitoneal metastases, with stable disease after seven years of follow-up Thalidomide is a low toxicity agent that acts as an inhibitor of vascular neogenesis, and seems ... contributions All the authors have read and approved the final version of this manuscript CR, EH and PS assembled the clinical data and wrote the paper EH, LW, JL and PS were involved in the clinical care ... disease bulk with thalidomide treatment; however, our patient has remained clinically and radiologically stable over a period in excess of seven years More recently, the case of a patient treated...
- 4
- 295
- 0
Báo cáo y học: "Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report" docx
... was placed in the anatomic position Part of the native head was used as a morselised autograft at the true acetabular bed The superolateral part of the head was used as a structural graft and secured ... technical difficulties of antegrade nailing due to the distorted anatomy and the limited ability of intraoperative traction and manipulation because of hip ankylosis in 15° of flexion and as a result ... Tsakotos et al.: Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report Journal of Medical Case Reports 2010 4:221 Figure Distal anteroposterior X-ray at...
- 4
- 355
- 0
Báo cáo y học: "Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case repor" ppt
... was placed in the anatomic position Part of the native head was used as a morselised autograft at the true acetabular bed The superolateral part of the head was used as a structural graft and secured ... technical difficulties of antegrade nailing due to the distorted anatomy and the limited ability of intraoperative traction and manipulation because of hip ankylosis in 15° of flexion and as a result ... Tsakotos et al.: Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report Journal of Medical Case Reports 2010 4:221 Figure Distal anteroposterior X-ray at...
- 4
- 289
- 0
Báo cáo y học: " Successful treatment of HIV-associated multicentric Castleman’s disease and multiple organ failure with rituximab and supportive care: a case report" potx
... creatinine and was admitted to the ICU for haemofiltration Antiretroviral therapy was continued on the ICU with ritonavir-boosted lopinavir and saquinavir Abacavir and lamivudine, which the patient was ... with autoimmune haemolytic anaemia (AIHA), a recognised association of MCD In addition she had elevated prothrombin (PT) and activated partial thromboplastin times (APTT), reduced platelets and ... biopsy an inguinal lymph mode, rather than a cervical node was based on the clinical findings of a large and easily palpable inguinal lymph node mass Although small volume bilateral cervical lymphadenopathy...
- 6
- 337
- 0
Báo cáo y học: " Prevalence of metabolic syndrome in patients with schizophrenia, and metabolic changes after 3 months of treatment with antipsychotics results from a German observational study" doc
... month-3 At baseline, patient demographics and characteristics were recorded At both visits, vital and physical parameters were collected, and fasting blood samples were drawn and analyzed Apart from ... resulted in treatment guidelines which demand the regular monitoring of relevant physical and laboratory parameters; in several countries these are meanwhile regarded clinical standard of care [21,22] ... (HDL) Abbreviations: AHA/NHLB = American Heart Association/National Heart, Lung and Blood Institute; NCEP-ATP III = National Cholesterol Education Program, Adult Treatment Panel 3rd report According...
- 11
- 425
- 0
báo cáo khoa học:" Development and validation of a questionnaire on ‘Satisfaction with dermatological treatment of hand eczema’ (DermaSat)" potx
... doi:10.1186/1477-7525-8-127 Cite this article as: Ruiz et al.: Development and validation of a questionnaire on ‘Satisfaction with dermatological treatment of hand eczema’ (DermaSat) Health and Quality of Life Outcomes ... (0.32) and glaucoma (0.30) treatments; and also with General Satisfaction Page 13 of 16 (0.59), as compared to generic (0.35) and glaucoma (0.28) Summarizing, the structure of patient treatment satisfaction ... with treatment, a parameter that seems to have a substantial influence on quality of life and therapeutic compliance [4-6] Patient satisfaction is related to all aspects of health care that are...
- 16
- 439
- 0
Báo cáo y học: "Endovascular Treatment of Bilateral Carotid Artery Occlusion with Concurrent Basilar"
... beginning of the ICA Begnning of the ICA Symptom Other aeurysms SAH PCA SAH No SAH No Hydrocephalus No Thalamic hematoma Collateral circulation VA→ECA→IC A Subclavian artery →CCA→ICA ECA→ICrA No SCA+AICA+PIC ... external carotid artery to anastomosis of the intracranial artery; in one case, no anastomosis 3.3 Treatment (1) Basilar apex aneurysm: conservative treatment in cases, clipping treatment by craniotomy ... bilateral internal carotid artery occlusion: case report Surg Neurol 1999;52:617-22 Araki T, Fujiwara H, Yasuda T, et al A case of aneurysmal subarachnoid hemorrhage associated with bilateral...
- 7
- 515
- 0
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends
... states of India have reserve a total of 1.72 million hectares of land for Jatropha cultivation and small quantities of Jatropha biodiesel are already being sold to the public sector oil companies ... supplement in animal feed, if the toxins are removed [23] Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen ... using heated distilled water was carried out to remove some unreacted remainder of methanol and catalyst which if not removed can react and damage storing and fuel carrying parts During washing...
- 12
- 568
- 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC Gene ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC...
- 16
- 646
- 0
Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx
... pool Using a combination of a primer complementary to the adapter (adapter primer: 5¢-CCATCCTAATACGACTCACTA TAGGGC-3¢) and a gene-specific sense primer (5¢-GCCG CTCGAGTTTGAGTTAGCCAGAAACTCC-3¢, ... and precipitated using EtOH and sodium acetate After extensive washing the DNA was redissolved in Tris/EDTA, pH 8.0 and separated on a · Tris/borate/EDTA, 0.9% agarose gel After capillary transfer ... of the order rodentia using the same data as Graur In contrast, the distance matrix algorithms again placed the guinea pig together with artiodactyls and primates, thus supporting paraphyly albeit...
- 9
- 671
- 0
WHO guidelines on the pharmacological treatment of persisting pain in children with medical illnesses docx
... initial evaluation of pain and the implementation of the pain management plan > 34 Emotional disturbances, such as fear, anxiety and emotional stress, can be both a risk factor and an outcome of ... children with cancer Metastatic spinal cord compression may be a cause of acute back pain and metastatic brain tumour can cause severe headaches Mucositis after chemotherapy or radiotherapy is also a ... discontinuation or a dosage decrease after repeated administration of a pharmacological agent Withdrawal syndrome can also be caused by the administration of an antagonist 9< EXECUTIVE SUMMARY Pain...
- 172
- 4,030
- 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... rational maps with Siegel disks; see for example [P2] and [Mc2] for the case of quadratic polynomials, and [Z1] and [YZ] for variants in the case of cubic polynomials and quadratic rational maps ... π/3 with S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ... asymptotically universal Similarly, bn , we say that an and bn are comparable up to a constant when an which is asymptotically universal Finally, let {an = an (x)} and {bn = bn (x)} depend on a parameter x...
- 53
- 383
- 0
Confessions of a Young Man pot
... "Papa." A young man of refined mind can look through the glass of the years He has sat in the stalls, opera-glass in hand; he has met women of thirty at balls, and has sat with them beneath shadowy ... sense of nearness; I am one with them in their ideas and aspirations, and when I am with them, I am alive with a keen and penetrating sense of intimacy Shall I explain this by atavism? Was there a ... perspective, anatomy, and la jambe qui porte; and we found all this in Julien's studio A year passed; a year of art and dissipation one part art, two parts dissipation We mounted and descended at pleasure...
- 91
- 420
- 0
Confessions of a Young Man potx
... ideas and aspirations, and when I am with them, I am alive with a keen and penetrating sense of intimacy Shall I explain this by atavism? Was there a French man or woman in my family some half ... seemed at an end I looked upon a blank space of years desolate as a grey and sailless sea "What shall I do?" I asked myself, and my heart was weary and hopeless Literature? my heart did not answer ... perspective, anatomy, and la jambe qui porte; and we found all this in Julien's studio A year passed; a year of art and dissipation one part art, two parts dissipation We mounted and descended at pleasure...
- 82
- 324
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25