treatment of a partially edentulous patient with implant retained removable partial denture prosthesis
báo cáo khoa học: "Successful treatment of a T4 lung tumor with vertebral body invasion using fiducial markers in the thoracic spine for image-guided radiation therapy: A case report" pps
... Shirato H, Harada T, Harabayashi T, Hida K, Endo H, Kitamura K, Onimaru R, Yamazaki K, Kurauchi N, Shimizu T, Shinohara N, Matsushita M, DosakaAkita H, Miyasaka K: Feasibility of insertion/implantation ... conventionally fractionated radiation treatment of a lung tumor The application of IGRT using fiducial markers in the spine in our patient allowed for radiation treatment of primary lung cancer with ... megavoltage (MV) images and allow for matching of patient anatomy to bony landmarks on a DRR Yin et al [8] at Henry Ford Hospital have used KV X-ray imaging with anatomy matching to vertebral bodies...
- 5
- 279
- 0
báo cáo hóa học: " Multinational development of a questionnaire assessing patient satisfaction with anticoagulant treatment: the ''''Perception of Anticoagulant Treatment Questionnaire'''' (PACT-Q©)" docx
... generate an initial list of concepts related to the expectations and satisfaction of patients with anticoagulant treatment The concept list was created in English and was based on the patients' main ... important aspects of their treatment and disease management, 3) identify how patients assess the efficacy and safety of their anticoagulant treatment and their preferences, 4) identify advantages and ... to evaluate the full benefits of anticoagulant treatments, a specific patient- reported questionnaire that assesses patients' satisfaction with anticoagulant treatment is thus required Ideally,...
- 13
- 585
- 0
Báo cáo y học: "Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report" docx
... was placed in the anatomic position Part of the native head was used as a morselised autograft at the true acetabular bed The superolateral part of the head was used as a structural graft and secured ... Tsakotos et al.: Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report Journal of Medical Case Reports 2010 4:221 Figure Distal anteroposterior X-ray at ... technical difficulties of antegrade nailing due to the distorted anatomy and the limited ability of intraoperative traction and manipulation because of hip ankylosis in 15° of flexion and as a result...
- 4
- 355
- 0
Báo cáo y học: "Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case repor" ppt
... was placed in the anatomic position Part of the native head was used as a morselised autograft at the true acetabular bed The superolateral part of the head was used as a structural graft and secured ... Tsakotos et al.: Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report Journal of Medical Case Reports 2010 4:221 Figure Distal anteroposterior X-ray at ... technical difficulties of antegrade nailing due to the distorted anatomy and the limited ability of intraoperative traction and manipulation because of hip ankylosis in 15° of flexion and as a result...
- 4
- 289
- 0
báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot
... as: Takigami et al., Functional bracing for delayed union of a femur fracture associated with Paget's disease of the bone in an Asian patient: a case report Journal of Orthopaedic Surgery and ... and treatment J Oral Pathol Med 1994, 23:12-16 Hashimoto J, Ohno I, Nakatsuka K, Yoshimura N, Takata S, Zamma M, Yabe H, Abe S, Terada M, Yoh K, et al.: Prevalence and clinical features of Paget's ... disease in Australia, New Zealand, North America and most European countries, but it has a low incidence in Scandinavia, and is extremely rare in the Japanese population, with a prevalence of...
- 4
- 402
- 0
Báo cáo khoa học: "Surgical treatment of a rare primary renal carcinoid tumor with liver metastasis" docx
... with advanced disease Response rate has been variable and may correlate to octreotide scan, but stabilization of disease has been seen in 36 to 70% of patients, with a mean duration of 12 months ... The median patient age was 49 years, with a range of 12 to 68 years Calcifications were present on 26.5% of imaging studies Median tumor size was 8.4 cm (range 1.5 to 30 cm) with 73.6% of patients ... year after her initial surgery, with no evidence of tumor recurrence Case presentation We evaluated a 45 year-old patient who presented initially with abdominal pain Abdominal and pelvic CT scan...
- 4
- 329
- 0
Báo cáo y học: "Heel raises versus prefabricated orthoses in the treatment of posterior heel pain associated with calcaneal apophysitis (Sever’s Disease): study protocol for a randomised controlled trial" ppt
... reliable data being available regarding calcaneal apophysitis causation and no clinical trial comparing treatment approaches, no clinical treatment path can be determined as “best practice” [19], therefore ... Frankston, Peninsula Health, Frankston, Australia 3Allied Health Clinical Research Unit, Southern Health, Cheltenham, Australia 4Physiotherapy Department, Monash University, Frankston, Australia ... the calcaneal apophysis (i.e., posterior aspect of heel) with pain on palpation (positive calcaneal squeeze medial and lateral borders), have not in the last 12 months been diagnosed fracture...
- 7
- 516
- 0
báo cáo khoa học: "Successful treatment of a free-moving abdominal mass with radiation therapy guided by conebeam computed tomography: a case report" potx
... Cite this article as: Dabaja et al.: Successful treatment of a free-moving abdominal mass with radiation therapy guided by cone-beam computed tomography: a case report Journal of Medical Case Reports ... analyzed and interpreted the patient data regarding the radiation treatment MRS analyzed the technical data, particularly use of the conebeam CT PH helped obtain consent and provided patient care ... part of vertebral body S2 Disease was evident in the mediastinum and right pleural area but was not causing any symptoms at that time, and the decision was made to administer palliative radiation...
- 4
- 375
- 0
báo cáo khoa học: "Development of a duodenal gallstone ileus with gastric outlet obstruction (Bouveret syndrome) four months after successful treatment of symptomatic gallstone disease with cholecystitis and cholangitis: a case report" pps
... the day of admission revealed a normal pancreatic duct and a small pigmented gallstone of the CBD that was extracted with an extraction balloon after endoscopic Page of Table Laboratory data for ... on a CT scan and because we were planning a one-stage surgery, we performed a laparotomy instead of choosing a laparoscopic approach Conclusion In a patient with gallstone disease with abdominal ... count of 14.3 cells/nL, an elevated C-reactive protein (CRP) level of 25.9 mg/dL, mildly elevated plasma aspartate aminotransferase and alanine aminotransferase (AST and ALT) levels of 51 U/L and...
- 5
- 272
- 0
báo cáo khoa học: " Successful treatment of metastatic hepatic epithelioid hemangioendothelioma with thalidomide: a case report" potx
... pulmonary, hepatic and retroperitoneal metastases, with stable disease after seven years of follow-up Thalidomide is a low toxicity agent that acts as an inhibitor of vascular neogenesis, and seems ... disease bulk with thalidomide treatment; however, our patient has remained clinically and radiologically stable over a period in excess of seven years More recently, the case of a patient treated ... significant treatment- related toxicity Case presentation A 53-year-old Caucasian British woman originally presented to her local hospital in 2002 with shortness of breath secondary to atrial fibrillation...
- 4
- 295
- 0
báo cáo khoa học:" Development and validation of a questionnaire on ‘Satisfaction with dermatological treatment of hand eczema’ (DermaSat)" potx
... with treatment, a parameter that seems to have a substantial influence on quality of life and therapeutic compliance [4-6] Patient satisfaction is related to all aspects of health care that are ... sample was finally set at 213 analyzable patients, whose average age was 43 years (SD = 13.6) and whose ages ranged from 19 to 83 years Of this sample, 59% were women The majority was Caucasian ... (0.32) and glaucoma (0.30) treatments; and also with General Satisfaction Page 13 of 16 (0.59), as compared to generic (0.35) and glaucoma (0.28) Summarizing, the structure of patient treatment satisfaction...
- 16
- 439
- 0
Bóa cáo y học: "Erroneous measurement of haemodynamic parameters by PiCCO™ monitor in a critically ill patient with renal replacement therapy: a case report" pot
... patient was admitted They discovered the erroneous measurement with the help of EC -A, who was in charge of the patient the following day All authors participated in the draft of the manuscript, and ... intensive care unit: Clinical review Crit Care 2002, 6:52-59 Sakka SG, Ruhl CC, Pfeiffer UJ, Beale R, MvLuckie A, Reinhart K, Meier-hellmann A: Assessment of cardiac preload and extravascular lung water ... there was an alteration of the area under the curve obtained by the injection of cool saline We think the same alteration would be produced by any catheter, if calibration is done during haemodialysis,...
- 2
- 273
- 0
Báo cáo y học: "Acute atomoxetine treatment of younger and older children with ADHD: A meta-analysis of tolerability and efficacy" ppsx
... interval, and laboratory parameters, treatment difference within each age category was assessed using an ANOVA model with a treatment term Consistency of treatment effect across age groups was assessed ... AE: adverse event; ANCOVA: analysis of covariance; ANOVA: analysis of variance; ATX: atomoxetine; CGI-ADHD-S: Clinical Global Impression of ADHD Severity; CPRS-R:S: Conners' Parent Rating Scale-revised; ... Measure ADHD-RS Total Mean SD Mean SD ES p Valuea p Valueb p Valueb 6–7 ATX PBO ATX PBO ATX PBO ATX PBO ATX PBO ATX PBO ATX PBO ATX PBO ATX PBO ATX PBO ATX PBO ATX PBO ATX PBO ATX PBO ATX PBO ATX...
- 9
- 415
- 0
Báo cáo y học: "Endovascular Treatment of Bilateral Carotid Artery Occlusion with Concurrent Basilar"
... beginning of the ICA Begnning of the ICA Symptom Other aeurysms SAH PCA SAH No SAH No Hydrocephalus No Thalamic hematoma Collateral circulation VA→ECA→IC A Subclavian artery →CCA→ICA ECA→ICrA No SCA+AICA+PIC ... external carotid artery to anastomosis of the intracranial artery; in one case, no anastomosis 3.3 Treatment (1) Basilar apex aneurysm: conservative treatment in cases, clipping treatment by craniotomy ... bilateral internal carotid artery occlusion: case report Surg Neurol 1999;52:617-22 Araki T, Fujiwara H, Yasuda T, et al A case of aneurysmal subarachnoid hemorrhage associated with bilateral...
- 7
- 515
- 0
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends
... states of India have reserve a total of 1.72 million hectares of land for Jatropha cultivation and small quantities of Jatropha biodiesel are already being sold to the public sector oil companies ... supplement in animal feed, if the toxins are removed [23] Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen ... Gravalos I., Gialamas T., Koutsofitis Z., Kateris D., Xyradakis P., Tsiropoulos Z., Lianos G Comparison of performance characteristics of agricultural tractor diesel engine operating on home and...
- 12
- 568
- 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC Gene ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC...
- 16
- 646
- 0
Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx
... pool Using a combination of a primer complementary to the adapter (adapter primer: 5¢-CCATCCTAATACGACTCACTA TAGGGC-3¢) and a gene-specific sense primer (5¢-GCCG CTCGAGTTTGAGTTAGCCAGAAACTCC-3¢, ... of the order rodentia using the same data as Graur In contrast, the distance matrix algorithms again placed the guinea pig together with artiodactyls and primates, thus supporting paraphyly albeit ... bp and an ORF of 1503 bp coding for a putative mitochondrial preprotein of 501 amino acids with a calculated molecular weight of 57.7 kDa (Fig 2) After Leu24 a cleavage site for the matrix-associated...
- 9
- 671
- 0
WHO guidelines on the pharmacological treatment of persisting pain in children with medical illnesses docx
... discontinuation or a dosage decrease after repeated administration of a pharmacological agent Withdrawal syndrome can also be caused by the administration of an antagonist 9< EXECUTIVE SUMMARY Pain ... children with cancer Metastatic spinal cord compression may be a cause of acute back pain and metastatic brain tumour can cause severe headaches Mucositis after chemotherapy or radiotherapy is also a ... ask what pain management treatments have previously been used, as well as the efficacy of any treatments Following this assessment, a detailed pain management plan, including pharmacological and...
- 172
- 4,030
- 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... π/3 with S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ... rational maps with Siegel disks; see for example [P2] and [Mc2] for the case of quadratic polynomials, and [Z1] and [YZ] for variants in the case of cubic polynomials and quadratic rational maps ... boundary of a drop U of minimal generation It then follows the boundary of U along a nontrivial arc I Finally, it returns along the boundaries of another chain of descendants of U until it reaches a...
- 53
- 383
- 0
Báo cáo Y học: Characterization of a partially folded intermediate of stem bromelain at low pH ppt
... (MRE) values were calculated according to Chen et al [35] and plotted against denaturant concentration Fraction of protein denatured ( fD) was calculated according to Tayyab et al [36] Acrylamide ... globule state at pH 0.8 but greater than that of the native state Acrylamide quenching data clearly show that stem bromelain at pH 2.0 is in an unfolded state as compared to the protein at neutral pH ... cysteine proteinases actinidin, papain and papaya proteinase omega Three dimensional structure of papaya proteinase omega deduced by knowledge-based modelling and active-centre characteristics determined...
- 6
- 495
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25