this video of an inline skater coming toward the viewer is also given a motion tween that rotates and enlarges it enhancing the excitement
Life cycle assessment (LCA) of an energy recovery plant in the olive oil industries
... land use change risks due to displacement, but that the risk is small and can be ignored for feedstock produced from wastes and on degraded land and also on set-aside and idle land, as well as ... composed of mandatory elements (classification and characterisation) that convert LCI results into an indicator for each impact category, and optional elements (normalization and weighting) that lead ... and spreading associated with energy crops One of the problems that has to be considered as well, though it is beyond the scope of this paper, is the fact that the demand for grain and corn as...
- 12
- 647
- 1
Tài liệu Báo cáo khoa học: "Evaluating the Accuracy of an Unlexicalized Statistical Parser on the PARC DepBank" docx
... time mation in the PoS tags and by the need to balance depth of analysis against the size of the derivation space On the Susanne corpus, the geometric mean of the number of analyses for a sentence ... overlap as both annotations contain such a relation between call(ed) and Ten), but the GR annotation also includes this relation between limit and effort(s) and reject and justice(s), while DepBank ... Briscoe and A Sanfilippo 1998 Parser evaluation: a survey and a new proposal In Proceedings of the 1st International Conference on Language Resources and Evaluation, Granada, Spain 447–454 Clark,...
- 8
- 543
- 0
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot
... domain of EW29 at pH 6.1 and 298K in the sugar-free state Cross-peaks are labeled based on an analysis of through-bond connectivities The side chains of NH2 resonances of asparagines and glutamines ... showing a slow exchange regime are in red and those showing a fast exchange regime and Dav ⁄ Dmax > 0.2, where Dav is the normalized weighted average of the 1H and 15N chemical-shift changes and Dmax ... for lactose and b-Me-Gal was in the slow exchange regime, whereas that for melibiose and a- Me-Gal, as anomers of lactose and b-Me-Gal, was in the intermediate exchange regime Thus, the configuration...
- 11
- 458
- 0
Báo cáo lâm nghiệp: "Effect of an oil heat treatment on the leachability and biological resistance of boric acid impregnated wood" pps
... impact of these combinations is evaluated for boron retention and biological resistance to termites and decay fungi MATERIALS AND METHODS 2.1 Wood material and chemicals Sapwood specimens of Japanese ... attacks and fungi decay, especially for sapstain and mold fungi because of their non toxicity to those organisms [19] This paper deals with the possibility of combining a boron impregnation and ... know that longitudinal exchanges are usually blocked by a three centimetres oil layer Thus treatment result is application of an oil layer of about 1.5 mm thick on tangential and radial surfaces...
- 6
- 417
- 0
Báo cáo khoa học: "Targeted surveillance to assess the presence of BSE in the age risk population of cattle slaughtered in Bursa, Turkey: preliminary results of an immunohistochemical detection study for the 2004-2005 period" pdf
... emas eht fo noitces snoitadnemmocer eht ni ,suhT ]7[ yekruT fo egnellahc lanretxe eht desaercni dna dreh elttac lanoitan eht deretne evah thgim elttac eseht fo noitcarf llams a taht demussa troper ... elttac ksir-ta eht morf slamina citamotpmysa fo gnilpmas eht gnisaercni yb edam eb dluohs metsys ecnallievrus evitca eht gnidnapxe dna ecnallievrus evissap eht fo tnemevorpmi taht detats saw ti ,troper ... snoitcurtsni s’rerutcafunam eht ot gnidrocca deraperp seussit eht htiw ,dezilitu saw )ASU ,DRMV ;99/CHI -EST namlluP( 1.6.79/99F ydobitna lanolconom elbaliava yllaicremmoc a ,CHI eht roF gniniats...
- 3
- 237
- 0
Báo cáo y học: "Screening of an endothelial cDNA library identifies the C-terminal region of Nedd5 as a novel autoantigen in systemic lupus erythematosus with psychiatric manifestations" ppt
... interpretation of data MR carried out the ELISA experiments and participated in analysis of data CA performed the statistical analysis and the clinical associations AS participated in the analysis and ... interpretation of data and in the revision of the manuscript RR participated in the design of the study and in the revision of the manuscript EP participated in analysis of data GV participated in the ... Alessandri C, Capoano R, Profumo E, Siracusano A, Salvati B, Rigano R, et al.: Screening of a HUAEC cDNA library identifies actin as a candidate autoantigen associated with carotid atherosclerosis...
- 8
- 375
- 0
Báo cáo y học: " Effectiveness of an intercultural module added to the treatment guidelines for Moroccan and Turkish patients with depressive and anxiety disorders" ppt
... properties of the translated instruments Other limitations of the study are that therapists will become aware of the intervention, and contamination between intervention and control group therapists can ... cultural knowledge the therapists are familiarized with the Moroccan and Turkish patients’ background and learn about: • the specific cultural aspect and elements, • the impact of migration in ... face by a trained interviewer and partly self report Most of the interviewers are bilingual Besides sufficient command of the Dutch language the Turkish, Moroccan-Arabic and Berber languages are...
- 7
- 350
- 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx
... in an orientation-independent manner Transfection assays unequivocally demonstrate that both sites are functional and suggest that the activity of this fragment is dependent of the GAF and Adf-1 ... downstream of transcriptional initiation sites in Drosophila promoters include ACGT, ACAA, ACAG, and AACA [32], and these were detected at )17, )18, )36 and )103 positions of the a- F1-ATPase gene ... GAGA and Adf-1 elements in the DNA are underlined The translation start codon and the main transcription start point are larger and in bold (B) Mutations either in the GAGA or Adf-1 binding sites...
- 11
- 532
- 0
Báo cáo khoa học: Transcription of mammalian cytochrome c oxidase subunit IV-2 is controlled by a novel conserved oxygen responsive element pptx
... CCAGAACGCGACCCAGGTC CAGGTCTGCAGAGCAAGCAACAG TAGTTGCAAGCTGAAGACCG GCTGAAGACCGCGGAGGTAC GAGGTACCCAGAACTGCCCTG GATAGTCAGTGGGGGAAACCTCAG CAGCAAAAGAGGGCTGTGTGGTG TGGCCGCCACGAACATCCCATC GTTGCCCAGGTTGGAGTGCAG ... CTCGCGGGCTCGGCAGTGGGAG AGTCTATTCTCGAGCACCTGGGACTACAGG AGTCTATTCTCGAGCCCAAAGCGCTGAGATTACAG AGTCTATTCTCGAGATGCTTCTGGAGTAGGAGGCA AGTCTATTCTCGAGGTGTGGAGGAGGCAGGGAGAC AGTCTATTCTCGAGGAGGCGCTCTGCAGTGCCTC AGTCTATTCTCGAGAAGCAGGACGTTCCCACGCTG ... USA) Quantification of EMSA bands After the gels had been scanned as described above, the intensities of individual bands were analysed with imagequant software (version 5, Molecular Dynamics) and...
- 12
- 333
- 0
Báo cáo sinh học: "Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" pot
... metastasis and angiogenesis Numerous pharmaceutical approaches have been undertaken to treat various human cancers using drugs that target EGFR family and more than 10 agents are in clinical ... post-operative radiation and/ or chemotherapy, and performance status of patients was unavailable for analysis Tissue microarray construction TMAs were constructed from archival formalin fixed, paraffin ... http://www.translational-medicine.com/content/9/1/126 Page of 10 Table Prognostic Factors in a Univariate and Multivariate Proportional Hazard Model of The Cox Regression Univariate analysis Multivariate analysis Her2 membranous staining NS...
- 10
- 490
- 0
báo cáo hóa học:" Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" doc
... metastasis and angiogenesis Numerous pharmaceutical approaches have been undertaken to treat various human cancers using drugs that target EGFR family and more than 10 agents are in clinical ... post-operative radiation and/ or chemotherapy, and performance status of patients was unavailable for analysis Tissue microarray construction TMAs were constructed from archival formalin fixed, paraffin ... http://www.translational-medicine.com/content/9/1/126 Page of 10 Table Prognostic Factors in a Univariate and Multivariate Proportional Hazard Model of The Cox Regression Univariate analysis Multivariate analysis Her2 membranous staining NS...
- 10
- 479
- 0
Autobiography and Letters of Orville Dewey, by Orville Dewey1Autobiography and Letters of Orville Dewey, by Orville DeweyThe Project Gutenberg EBook of Autobiography and Letters of Orville Dewey, D.D., by Orville Dewey This eBook is for the use of an pptx
... number of each Cole and Durand and Ingham and Inman and Chapman and Bryant and Verplanck and Charles Hoffman were in it when I first became acquainted with it; and younger artists have been brought ... He has Unitarian revivals that might match with any of them It is a curious fact that the Christians, as they call themselves, Unitarian as they ire, form the most extravagant, fiery, fanatical ... nature and the blessedness of life, beyond all other possible joy And, therefore, notwithstanding all that I have suffered, notwithstanding all the pain and weariness and anxiety and sorrow that...
- 141
- 503
- 0
Báo cáo hóa học: "Customizing Multiprocessor Implementation of an Automated Video Surveillance System" potx
... application,” ME thesis, The University of Auckland, Auckland, New Zealand, July 2005 C R Wren, A Azarbayejani, T Darrell, and A P Pentland, “Pfinder: real-time tracking of the human body,” IEEE Transactions ... McFarlane and C P Schofield, “Segmentation and tracking of piglets in images,” Machine Vision and Applications, vol 8, no 3, pp 187–193, 1995 C R Wren, A Azarbayejani, T Darrell, and A P Pentland, ... speed and ease of development of the model, but it a ects the accuracy of the developed model The XTMP simulator runs faster than a hardware description language (HDL) simulator as the simulator and...
- 12
- 279
- 0
Báo cáo y học: "Analysis of Fcγ receptor haplotypes in rheumatoid arthritis: FCGR3A remains a major susceptibility gene at this locus, with an additional contribution from FCGR3B" ppsx
... the laboratory work, analyzed the data and prepared the manuscript JHB gave additional statistical support and performed the haplotype analysis BG, RDS and PE participated in the collection of ... rheumatoid arthritis susceptibility One advantage of the HTR framework for analysis of haplotypes is that other factors can be included in the model The analysis was repeated including the RA-associated ... in Norwegian and Dutch RA patients [16,18], with a skewing toward the FCGR 3A- 158F allele in Spanish, Japanese and Indian populations [13-15,17] Many reasons for the lack of Page of (page number...
- 9
- 450
- 0
báo cáo khoa học: " Toward a treaty on safety and cost-effectiveness of pharmaceuticals and medical devices: enhancing an endangered global public good" pot
... cost-effectiveness analysis of pharmaceuticals ("CEAP") as a final component of safety and efficacy evaluation ("SE/CEAP")[7] The literature and institutional arrangements for cost-effectiveness analysis of ... carcinogenicity and mutagenicity) and then three phase human clinical trial data, are widely used for institutional approval (licensing or registration) of pharmaceuticals and a variety of other ... http://www.globalizationandhealth.com/content/2/1/5 munity can afford; medicines meeting appropriate standards of quality, safety and efficacy; quality use of medicines; and maintaining a responsible and viable...
- 9
- 448
- 0
An investigation into teachers' and students' attitudes toward the use of mother tongue in English language classrooms at Hongai High school
... feels that switching and negotiation between languages are a part and parcel of everyday language use for the majority of the world population These scholars have agreed that since the mother ... classroom is that it “allows for the language to be used as a meaning-making tool and for language learning to become a means of communicating ideas rather than an end in its self” ( Auerbach, ... English, but rather can assist in the teaching and learning process L1 use is an unavoidable phenomenon and the advantages of doing so outweigh any disadvantages However, it should bear in mind that...
- 48
- 920
- 0
Báo cáo y học: " Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis"
... Demographics Age, years Male Race / Ethnicity Caucasian, not Hispanic Non-Caucasian Hispanic Black, not Hispanic American Indian or Pacific Islander RA Drug Initiated Abatacept (5%) (3%) Adalimumab ... conception and design, and to the analysis and interpretation of the data TRM and GWC handled acquisition of data All authors contributed to the manuscript revision process, addressing important intellectual ... rheumatoid arthritis: A meta-analysis Arthritis Rheum 2006, 55:864-872 Wolfe F, Michaud K: Resistance of rheumatoid arthritis patients to changing therapy: discordance between disease activity and...
- 29
- 581
- 0
Báo cáo y học: "Effect of Acute Administration of an Herbal Preparation on Blood Pressure and Heart Rate in Humans"
... collection, approximately 72-75 after capsule ingestion Three analyses of the data were performed using x analysis of variance (ANOVA) For the first data analysis, treatment and time were the independent ... independent factors using all 23 subjects The second analysis separated and analyzed the data according to gender The third analysis assessed the data for differences in high caffeine and low-caffeine ... cardiovascular effects of C aurantium has been due, at least in part, to a lack of understanding of the differences in the pharmacokinetic and pharmacological properties between p-synephrine and...
- 6
- 490
- 0
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis
... Vietnam national University, Hanoi College of Foreign Languages Department of Postgraduate Studies A study oF An alternative approach to teaching essay writing to TOEFL learners (Nghiên ... Đổi phơng pháp dạy viết Luận cho học viên chứng ToefL) By: Nguyen Thi Chung Mien Supervisor: Do Ba Quy, MA Hanoi, 2005 ...
- 2
- 524
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25