Báo cáo khoa học: Transcription of mammalian cytochrome c oxidase subunit IV-2 is controlled by a novel conserved oxygen responsive element pptx

Transcription of mammalian cytochrome c oxidase subunit IV-2 is controlled by a novel conserved oxygen responsive element Maik Hu ¨ ttemann, Icksoo Lee, Jenney Liu and Lawrence I. Grossman Molecular Medicine and Genetics, Wayne State University School of Medicine, Detroit, MI, USA Oxygen sensing and the adaptation to varying oxygen concentrations are fundamental for the survival of species from bacteria to humans. Oxygen regulation can occur at both the intake stage and the usage stage. In higher organisms, which depend largely on aerobic energy metabolism, usage takes place largely at the last step of the mitochondrial respiratory chain, the transfer of electrons from cytochrome c to oxygen, catalyzed by cytochrome c oxidase (CcO; EC 1.9.3.1). In vertebrates, oxygen supply is also regulated via a unique mechanism in the lungs for hypoxic response. Other tissues (and, indeed, the bronchial circulatory system of the lung) react to a hypoxic trigger by vaso- dilation, thereby increasing blood flow to under-oxy- genated regions. In the pulmonary circulation of the lungs, however, the converse effect, hypoxic vasocon- striction, is critical for shunting blood to more highly ventilated regions to help optimize the ventilation of deoxygenated blood. Keywords electron transport chain; hypoxia; isoform; lung; mitochondria Correspondence L. Grossman or M. Hu ¨ ttemann, Molecular Medicine and Genetics, Wayne State University School of Medicine, 540 E. Canfield Ave., Detroit, MI 48201, USA Fax: + 1 313 5775218 Tel: + 1 313 5775326 or +1 3135779150 E-mail: l.grossman@wayne.edu, mhuttema@med.wayne.edu Database CcO4-2 promoter sequences, including exon I, have been submitted to the GenBank data library under the accession numbers: AY219183 (human), AY219183 (cow), AY219183 (rat) and AY219183 (mouse) (Received 18 July 2007, revised 30 August 2007, accepted 5 September 2007) doi:10.1111/j.1742-4658.2007.06093.x Subunit 4 of cytochrome c oxidase (CcO) is a nuclear-encoded regulatory subunit of the terminal complex of the mitochondrial electron transport chain. We have recently discovered an isoform of CcO 4 (CcO4-2) which is specific to lung and trachea, and is induced after birth. The role of CcO as the major cellular oxygen consumer, and the lung-specific expression of CcO4-2, led us to investigate CcO4-2 gene regulation. We cloned the CcO4-2 promoter regions of cow, rat and mouse and compared them with the human promoter. Promoter activity is localized within a 118-bp proxi- mal region of the human promoter and is stimulated by hypoxia, reaching a maximum (threefold) under 4% oxygen compared with normoxia. CcO4- 2 oxygen responsiveness was assigned by mutagenesis to a novel promoter element (5¢-GGACGTTCCCACG-3¢) that lies within a 24-bp region that is 79% conserved in all four species. This element is able to bind protein, and competition experiments revealed that, within the element, the four core bases 5¢-TCNCA-3¢ are obligatory for transcription factor binding. CcO isolated from lung showed a 2.5-fold increased maximal turnover compared with liver CcO. We propose that CcO4-2 expression in highly oxygenated lung and trachea protects these tissues from oxidative damage by accelerat- ing the last step in the electron transport chain, leading to a decrease in available electrons for free radical formation. Abbreviations CcO, cytochrome c oxidase; CcO4-2, CcO subunit 4-2 gene; Egr1, early growth response factor 1; EMSA, electrophoretic mobility shift assay; HIF-1a, hypoxia-inducible factor 1a; ORE, oxygen responsive element; OREF, ORE binding factor; RACE, rapid amplification of cDNA ends; ROS, reactive oxygen species. FEBS Journal 274 (2007) 5737–5748 ª 2007 The Authors Journal compilation ª 2007 FEBS 5737 At the gene level, a major breakthrough for the understanding of oxygen sensing was the discovery of hypoxia-inducible factor 1a (HIF-1a) [1], which, during hypoxia, activates at least 60 genes involved in energy metabolism, erythropoiesis and vasculariza- tion. It is clear, however, that HIF-1 is not adequate to explain ischemic cellular pathophysiology. For example, ferrets develop profound pulmonary hyper- tension when chronically exposed to oxygen concen- trations of 10%, whereas, in ex vivo ferret lungs, HIF-1a expression is not observed until oxygen con- centration goes below 7%, rises somewhat at 4% but still does not increase dramatically until 0–1.3% [2]. In addition, the deposition of fibrin in the lung vasculature, which is a consequence of the induction of procoagulant tissue factor, is independent of HIF-1 [3], and has been shown to result from hypoxia-mediated induction or activation of the tran- scription factor early growth response factor 1 (Egr1) [4]. Our finding, reported here, that a new isoform of CcO subunit 4 (CcO4-2), which is expressed in lung and trachea [5], is regulated by oxygen concen- tration adds a new component to the mechanism of pulmonary oxygen sensing. Furthermore, the recent demonstration that HIF-1 stimulates CcO4-2 expres- sion under hypoxia [6], whilst down-regulating mito- chondrial metabolism [7–9], underscores the role of mitochondria in the hypoxic response. The mecha- nism for oxygen sensing in the lung is still unre- solved. Considerable data have suggested that the sensor resides in the mitochondrial electron transport chain [10–13], although contrary evidence has recently been presented [14]. Whilst this work was in progress, Horvat et al. [15] suggested that CcO4-2 is present in several mouse brain cell types under hypoxic conditions. We demonstrate in this report that CcO4-2 is oxy- gen-regulated at the transcriptional level. It is induced under hypoxia via a conserved, novel, oxygen respon- sive element (ORE) in the proximal promoter that can be separated from the well-characterized HIF-1 system. Results CcO4-2 is a respiratory system isoform Strong transcription signals of CcO4-2 in smooth mus- cle of the lung [5] led us to investigate transcript levels in other nonlung smooth muscle tissues by quantitative PCR. Compared with lung (100%), small intestines showed only trace amounts (< 0.5%), aorta 4.8% and trachea 100%, which extends CcO4-2 expression in the respiratory system but not to the other smooth muscle tissues examined. Phylogenetic footprinting utilizing ‘one-way PCR’ reveals a 24-bp conserved region in the CcO4-2 promoter We cloned and sequenced the promoter region of cow, rat and mouse utilizing one-way PCR (see Experimen- tal procedures; Fig. 1A). The alignment of the proxi- mal promoter sequences, including human, revealed low identities, except for a 24-bp region conserved in all four species (Fig. 1B, black bar). Within the 400-bp Fig. 1. (A) Schematic representation of ‘one-way PCR’. This method is an extension of RACE PCR, and allows the rapid characterization of unknown upstream or downstream genomic DNA sequences (see Experimental procedures). A short sequence length must be known, e.g. an exonic sequence derived from a cDNA. Three subsequent primers directed to the region of interest are generated from the known sequence; here, the CcO4-2 promoter sequences of cow, mouse and rat were amplified. The outermost primer P-1 is used to linearly amplify into the unknown region using genomic DNA as template. The length-heterogeneous single-stranded fragments are polyadenylated. In one reaction, a poly(T) primer, which contains an appended sequence (outer ⁄ inner) for later PCRs, is annealed to the poly(A) tails of the fragments, counter strand synthesis is performed as a single PCR cycle, followed by an outer PCR with the next inner primer P-2 and Q outer . To increase specificity, a nested PCR is performed with primers P-3 and Q inner and 1 lL of a 1 : 50 dilution of the outer PCR as template. PCR products, separated by agarose gel electrophoresis, usually appear as a smear. Fragments of the desired size are gel extracted, cloned and sequenced. (B) Alignment of the CcO4-2 promoter sequences. Proximal promoter sequences, including exon I from human, cow, rat and mouse, were aligned with the program MEGALIGN using the CLUSTAL algorithm. Identical bases are indicated with an asterisk. Transcription factor binding sites are underlined and specified for the human promoter. Probes used for EMSA experiments are boxed. Mutations used for control probes for EMSA and mutations introduced by site-directed mutagenesis for reporter gene analysis are indicated above the underlined elements in italics. Exon I sequences are italicized. The start ATG is located in exon II (not shown). The starting points of reporter gene constructs 4–7 in Fig. 1C are indicated with arrows and fragment sizes. A 24-bp region, conserved in all four species (black bar), is composed of a novel oxygen responsive element (ORE) and the adjacent Sp1 A site. A HIF-1a element that has recently been suggested to regulate CcO4-2 [6] is underlined. (C) Human CcO4-2 gene activity is driven by the ) 140-bp proximal promoter region. Firefly luciferase reporter gene activity was normalized to cotransfected Renilla luciferase reporter gene activity, and relative reporter activities were standard- ized against the wild-type 579-bp construct reporter gene activity (set to 100%) after transfection and incubation under 20% oxygen for 40 h. Control, reporter gene vector without inserted DNA (basal activity). Cytochrome c oxidase subunit IV-2 hypoxic response M. Hu ¨ ttemann et al. 5738 FEBS Journal 274 (2007) 5737–5748 ª 2007 The Authors Journal compilation ª 2007 FEBS promoter regions, including exon I, human and cow share 52% and rat and mouse share 72% sequence identity, whereas overall identities become insignificant between the human ⁄ cow and rat ⁄ mouse groups (26– 28%). Human CcO4-2 gene activity is driven by the 118-bp proximal promoter region Seven deletion fragments from the human CcO4-2 pro- moter were cloned in front of the luciferase gene, and AC B M. Hu ¨ ttemann et al. Cytochrome c oxidase subunit IV-2 hypoxic response FEBS Journal 274 (2007) 5737–5748 ª 2007 The Authors Journal compilation ª 2007 FEBS 5739 reporter activity was tested in H460 human lung cells (Fig. 1C). Constructs starting from 2650 to 118 bp revealed similar reporter activities, followed by an 80% drop in activity obtained with the 76-bp construct. We concluded that the main regulatory elements are within the )118-bp proximal region (see below). A novel ORE mediates hypoxia-induced human CcO4-2 gene activity In order to investigate oxygen as a potential regulator for CcO4-2 gene activity, we analyzed the 579- and 203-bp reporter constructs under both standard 20% oxygen cell culture conditions and at 2% oxygen. Both reporter constructs showed more than twofold induc- tion under hypoxia (Fig. 2A, constructs 1 and 2). Analysis of the human promoter with the program TFsearch [16] for potential transcription factor binding sites revealed three Sp1-like elements (Sp1 A,B,C ), one of which is part of the 24-bp conserved region (Fig. 1B). The three elements were altered by site-directed muta- genesis of the 579-bp promoter construct, and activity was evaluated at 2% and 20% oxygen. These experi- ments revealed that each is necessary for maximal pro- moter activity, but none is abolished by hypoxic induction after mutation (Fig. 2A, constructs 4, 5 and 6). An additional construct was generated that con- tained mutations in the conserved 24-bp region (ORE in Fig. 1B) upstream of the Sp1 A site. Mutation of this element significantly reduced reporter activity and, importantly, also eliminated CcO4-2 hypoxic induction, assigning oxygen responsiveness to the new element (Fig. 2A, construct 3). Double mutations (Fig. 2A, con- structs 7 and 8) are approximately additive and, when ORE is one of them, show a loss of hypoxic stimulation. CcO4-2 hypoxic response is threefold induced at 4% oxygen We analyzed the CcO4-2 hypoxic response in H460 cells between zero (set to 100%) and 20% oxygen. 350 20% Oxygen 4% Oxygen Reporter gene activity (%) 300 250 200 150 100 50 0 A B C Fig. 2. (A) Human CcO4-2 promoter activity is stimulated by hypoxia and mediated by a novel oxygen responsive element (ORE). Wild- type and site-directed mutagenesis constructs of the human CcO4- 2 promoter were transfected into human H460 cells that were grown under 20% (hatched bars) or 2% (filled bars) oxygen, and reporter gene activity was determined as in Fig. 1. A 2.2-fold induc- tion in promoter activity was observed for the 579-bp wild-type reporter (construct 1). Hypoxic stimulation is abolished when ORE is mutated (black rectangle, construct 3). All indicated elements contrib- ute to maximum promoter activity (open circles, Sp1-like). (B) CcO4-2 reporter gene activity is about threefold increased at 4% oxygen compared with normoxia, whereas the HIF-1a construct shows highest activity under anoxia. The reporter gene activity of the 579- bp human CcO4-2 (see Fig. 1C) and the HIF-1a response element (HRE) reporter constructs was examined in H460 cells under various oxygen concentrations, and standardized against identically treated cells incubated at 20% oxygen in parallel. (C) The 17-bp ORE was cloned in a promoterless reporter gene vector. A one- (left) and four- (middle) copy-containing construct with the correctly oriented sequence and the control plasmid (right) were transfected into H460 cells and incubated under 4% and 20% oxygen concentra- tions, revealing that the ORE by itself is able to both stimulate tran- scription and mediate the hypoxic response. Reporter activity for the one-copy-containing construct was 8.9% (± 0.5%) relative to the 579-bp construct (construct 1 in Fig. 2A) at 20% oxygen. Cytochrome c oxidase subunit IV-2 hypoxic response M. Hu ¨ ttemann et al. 5740 FEBS Journal 274 (2007) 5737–5748 ª 2007 The Authors Journal compilation ª 2007 FEBS Compared with normoxia, reporter gene activity was induced threefold at 4% oxygen, declining to about 1.7-fold induced at 0% (Fig. 2B, filled diamonds). To compare the CcO4-2 response with that of HIF-1, a reporter containing three HIF-1a regulatory elements was also introduced under the same conditions (Fig. 2B, open squares). In both cases, the reporter assay was performed after 40 h of incubation at each indicated oxygen concentra- tion. To determine the time delay necessary for 1.1 mL of fresh oxygen-saturated medium overlying the cells in a 24-well plate to equilibrate with the gas atmosphere, we positioned an oxygen electrode into a standard well and recorded media oxygen concentration over time (data not shown). Constant oxygen equilibrium concen- trations were obtained after about 3 h for 20% and 4% oxygen atmospheres, but not until more than 8 h for 0% oxygen. Thus, the incubation period of 40 h prior to reporter gene analysis allowed > 24 h exposure to the experimental oxygen concentration. We next cloned ORE in a promoterless vector to test whether its presence is sufficient to mediate a hyp- oxic response in the absence of other cis elements in the human promoter. A construct containing one copy of ORE produced a 2.8-fold induction of reporter gene activity at 4% oxygen compared with normoxia (Fig. 2C, left columns). However, the presence of three additional copies of the element in the same orienta- tion did not further increase the hypoxic response (Fig. 2C, second column pair). A construct containing mutations in ORE produced background reporter gene activity at both 4% and 20% oxygen, similar to the empty vector (Fig. 2C, right two column pairs). Thus, the element alone can act as a promoter and can medi- ate the hypoxic response. Electrophoretic mobility shift assay (EMSA) with ORE probe The analysis of protein–DNA interaction for ORE was performed with a probe containing part of the adjacent Sp1 A site and nuclear extract derived from H460 cells grown under 2% oxygen. Two complexes were formed (Fig. 3A, lane 2) that could be competed with unla- beled probe (lane 3). The upper band was shown to be a nonspecific artifact that could be competed with any oligonucleotide (Fig. 3D). Competition with the probe, but with ORE mutated again, competed the nonspe- cific upper band (Fig. 3A, lane 4, triangle) but not ORE with its binding factor (OREF) in the lower band (arrow). Antibodies against Sp3, Sp4, HIF-1a and CREB protein, to examine whether the cognate protein was part of the shifted band complex, gave negative results in all cases (Fig. 3A, lanes 8–12). Antibodies against transcription factors c-Rel and Ikaros, which were suggested by Genomatix software as candidates for binding to this sequence, also did not produce a supershift or interference with binding (not shown). Furthermore, neither the use of nuclear extract derived from H460 cells grown under 20% instead of 2% oxy- gen (not shown), nor the addition of potential regula- tory nucleotides ATP, ADP (not shown), NAD + and NADH (Fig. 3A, lanes 13–15), affected the relative intensity of the specific band. A partial characterization of the 5¢-upstream bases required for the interaction of OREF with ORE (Fig. 3B, lane 2) expands the core sequence identified by site-directed mutagenesis (Fig. 2A). We conclude from the above experiments and phylogenetic foot- printing (Fig. 1B) that the sequence 5¢-GGA(C ⁄ T) GTTCCCACGT-3¢ represents the minimum OREF recognition sequence. To further narrow the core bind- ing site, we performed experiments with competitor oligonucleotides for each position of the 15-bp region: for each nucleotide, a mixture of three competitors was generated containing the three bases not present in the human sequence. By applying a large excess (100-fold) of competitor mixture, only those reactions in which the particular base is absolutely required for protein binding will produce a shifted band (Fig. 3C, upper panel). Applying this method, we identified four essential bases 5¢-TCCCA-3¢ in the middle of the ORE sequence (Fig. 3C, boxed). A reduction in stringency by decreasing the amount of competitor DNA to a 10-fold excess revealed the participation of other bases with different signal intensities, and two bases (italicized) that do not seem to be required for factor binding (Fig. 3C, lower panel). Thus, the final consen- sus sequence from the above data is 5¢-GGA(C ⁄ T) NTTCNCACG(C ⁄ T). Lung CcO is a high-activity isozyme We isolated CcO from cow lung for the first time to our knowledge and also from cow liver, in both cases following our previous protocol [17]. Both isoforms of CcO subunit IV are expressed in lung. However, we obtained only a single band in the size range of sub- unit IV (Fig. 4A), most probably because of the very similar sizes of both isoforms. We then performed activity measurements. Functional differences between the lung and liver isozymes became obvious after kinetic analysis. CcO activity (turnover number) was measured by the polarographic method (Fig. 4B). Lung CcO is more than 2.5 times as active at maximal turnover than liver CcO. M. Hu ¨ ttemann et al. Cytochrome c oxidase subunit IV-2 hypoxic response FEBS Journal 274 (2007) 5737–5748 ª 2007 The Authors Journal compilation ª 2007 FEBS 5741 Discussion Our discovery of a new mammalian CcO isoform for regulatory subunit 4 [5], whose expression is specific to lung and trachea amongst the tissues examined, which is induced after birth, and whose transcription is dependent on oxygen concentration, points to a role for CcO in respiratory physiology. Strong expression within lung has been localized to smooth muscle, in both arteriole and bronchiole walls. Each of these locations may involve a different functional role and thus, consequently, a different regulatory circuitry. In bronchiole walls, our previous observation of CcO inhibition by the anti-asthma drug theophylline, A B C D Cytochrome c oxidase subunit IV-2 hypoxic response M. Hu ¨ ttemann et al. 5742 FEBS Journal 274 (2007) 5737–5748 ª 2007 The Authors Journal compilation ª 2007 FEBS followed by decreased ATP levels [17], suggests a role in airway constriction. In arteriole walls, muscle can regulate blood flow in response to hypoxic signals to ameliorate potential ischemic damage. In most cases, hypoxia triggers vaso- dilation in order to increase blood flow to under-oxy- genated tissue regions. Uniquely, in the pulmonary arterioles of the lung, however, hypoxia triggers vaso- constriction in order to shunt blood to better ventilated (apical) regions to improve the ventilation ⁄ perfusion ratio. As alveolar sacs do not contain a muscle compo- nent, hypoxic signals must be transmitted upstream to the terminal bronchioles. The nature of the initial hyp- oxic signal is unresolved, although considerable data tie it to the mitochondrial electron transport chain and, in particular, to the free radicals generated there [12,18,19]. Two general factors are known to increase free radical production in the mitochondria, the oxygen concentration and the redox state of the electron trans- port chain, because both oxygen and electrons are required substrates for radical formation. Lung cells face the highest (atmospheric) oxygen concentrations compared with other tissues. Therefore, special protec- tive adaptations would be expected that prevent excess free radical formation. One way to prevent electron build-up in the mitochondria would be to increase CcO activity, which has been shown to be the rate-limiting step in the electron transport chain under physiological conditions [20,21]. We have shown here that isolated CcO from lung is 2.5 times more active than liver CcO, and recent experiments with cells overexpressing CcO4-2 have shown that CcO4-2 is superior to CcO4-1 at dissipating H 2 O 2 build-up [6]. Taken together, the expression of CcO4-2 in the highly oxygenated tissues of lung and trachea, the increased activity of the iso- lated enzyme and the finding that CcO4-2-expressing cells produce fewer free radicals suggest a role in pro- tecting these tissues from radical damage. Interestingly, CcO4-2 evolved by gene duplication about 320 million years ago [5], a time when atmospheric oxygen concen- trations dramatically increased from an estimated hyp- oxic level of 13% in the Devonian to 35% hyperoxia Fig. 3. (A) EMSA with the [ 32 P]-labeled oxygen responsive element (ORE) probe yields two specific bands. The19-bp [ 32 P]-labeled ORE probe (bottom) contains four G nucleotides of the adjacent Sp1 site. The nuclear extract was prepared from H460 lung cancer cells grown under 2% (+) oxygen for 2 days. In each binding reaction, 60 lg of nuclear extract was applied. The two strongly shifted bands (lane 2) can be removed with a 50-fold excess of unlabeled competitor DNA (lane 3). Competitor DNA that contains mutations in ORE (indicated on the top of the probe sequence; lane 4) or competition experiments with an Sp1 fragment derived from the middle Sp1 site of the human promoter (Fig. 1B) in wild-type (lane 5) or mutated (lane 6) form largely eliminates the upper band (triangle), and thus reveals specific interaction of ORE with a corresponding transcription factor (arrow). Supershift experiments with Sp antibodies show interference only with an Sp1 anti- body (lane 8). Normal goat serum (N) and Sp3, Sp4, HIF-1a and CREB binding protein antibodies show no effect (lanes 7, 9–12). Similarly, the addition of 2 m M NAD + (lane 14) or NADH (lane 15) shows no effect on the lower band. Free probe at the bottom of each lane is not shown. (B) EMSA experiments performed with probes differing in sequence length revealed that, in addition to the core sequence as shown above the 5¢-upstream bases, GGA is necessary for transcription factor binding, because the lower band representing OREF–ORE interaction is abolished on its removal (lane 2). Probe sequences are indicated. Stars show bases conserved in the human, cow, rat and mouse promot- ers. (C) The definition of bases indispensable for transcription factor binding to ORE was performed via competition experiments using 15 oligonucleotides containing mutations at each position of the binding site as defined in (B) (lanes 2–16). Each competitor consists of a mix- ture of three oligonucleotides containing the bases not present in the ORE sequence (H, C ⁄ A ⁄ T; B, T ⁄ C ⁄ G; V, A ⁄ C ⁄ G; D, G ⁄ A ⁄ T). For exam- ple, the competitor in lane 2 contains three double-stranded oligonucleotides with C, A and T in the first position, excluding G present in the wild-type ORE. EMSA was performed under the conditions given in (A) using a 10- or 100-fold excess of unlabeled competitor as indicated. Only the lower band specific for OREF binding is shown (see (A), arrow). The absence of competitor DNA produces a similar signal, as observed with unspecific competitor under 10- or 100-fold excess (compare lanes 1 and 17; see Table 1 for oligonucleotide sequences). Using a 100-fold excess of competitor DNA reveals that four bases (boxed) are indispensable for OREF binding (lanes 8, 9, 11 and 12), because the corresponding competitor DNAs cannot compete with complex formation. Reducing the stringency by applying a 10-fold excess of competitor reveals signals with varying intensities for most positions (lanes 2–5, 7–9, 11–16), except for two bases (italicized) that do not seem to contribute to OREF binding (lanes 6 and 10). (D) EMSA experiments with ORE and Sp1 probes reveal that the upper band is non- specific for Sp1. The higher molecular weight complex could be competed with an unlabeled Sp1 B probe or the addition of Sp1 antibody [see (A), triangle; lanes 5 and 8, respectively]. Thus, in order to test whether the upper band is specific and contains Sp1, side-by-side com- petition experiments were performed using the ORE probe and an Sp1 consensus probe identical in length and GC ⁄ AT content (Table 1) with nuclear extract from H460 cells grown at 20% oxygen. In comparison with nuclear extract grown under hypoxia, normoxic nuclear extract leads to an increase in the upper band, but does not affect the intensity of the lower (specific) band. The Sp1 probe shows three bands, with the lowest band migrating at the position of the upper band obtained with the ORE probe (triangle; compare lanes 9 and 2, respectively). Using both probes, this band could be competed with wild-type and mutated Sp1 oligonucleotides (lanes 3, 4, 10, 11). In addi- tion, a mixture of unspecific oligonucleotides that do not contain Sp1-like sequences (see Table 1) efficiently abolishes the band already at low excess (lanes 6, 7, 13 and 14), indicating that the upper band obtained with ORE and the lowest band obtained with the Sp1 probe result from unspecific (sequence-independent) protein binding. This band is weakened on addition of Sp1 antibody (lanes 5 and 12); how- ever, using the Sp1 probe only, the top band (arrow) produces a specific supershift (star; compare lanes 9 and 12). M. Hu ¨ ttemann et al. Cytochrome c oxidase subunit IV-2 hypoxic response FEBS Journal 274 (2007) 5737–5748 ª 2007 The Authors Journal compilation ª 2007 FEBS 5743 during the Permian and Carboniferous, compared with the present 21%. Compared with other CcO subunit isoforms, mammalian CcO subunit 4 led to the genera- tion of the earliest isoform pair during a period with dramatic changes in oxygen concentration, the sub- strate of CcO, which further suggests an adaptation to higher oxygen concentrations. A recent report has suggested that CcO4-2 regula- tion is mediated by HIF-1a [6], and the authors identi- fied two such elements, one in the promoter (Fig. 2, double underline) and one in intron 1. The involve- ment of HIF-1a or HIF-2a in CcO4-2 regulation needs further evaluation because both elements are not conserved in mammals, and it remains to be shown whether, under physiological conditions, lung cells face such low oxygen concentrations under which HIF reg- ulation is operating (Fig. 2B). We found maximal CcO4-2 reporter gene activity at 4% oxygen, condi- tions under which regulation by HIF does not occur (Fig. 2B). Oxygen concentration in lung is clearly higher than that in other tissues, and 4% oxygen, as applied during our cell culture experiments, might rep- resent the physiological equivalent range present at the cellular level in lung tissue. The properties of CcO4-2 in withstanding oxidative stress (faster ability to utilize O 2 and produce ATP, whilst producing less H 2 O 2 and caspase activation) suggest that its expression may be found in other cell types where survival is critical. The question then arises as to why CcO4-2 has not become the dominant, tissue-unspecific isoform. The answer may be that it is not very conservative of energy because of its increased basal activity (Fig. 4B). Mitochondrial reactive oxygen species (ROS) have been shown to trigger hypoxia- stimulated responses, including transcription and cal- cium increases in pulmonary arterial myocytes [18,22]. Inhibitor studies to localize the ROS-producing seg- ment of the electron transport chain place it proximal to the ubisemiquinone site of complex III [11]. How- ever, inhibitors acting distal to ubisemiquinone, such as the CcO inhibitors cyanide and azide, can augment ROS generation by increasing the ubisemiquinone pool [10]. As discussed above, regulation of electron flux at CcO by subunit 4-2, in analogy with ATP regulation of CcO activity by subunit 4-1 [23], would be a way of modulating the redox state of the ubiquinone pool. Our results stimulate the determination of how oxy- gen concentration regulates CcO4-2 expression. The discovery of a novel 24-bp region in the proximal pro- moter, conserved between human, cow, rat and mouse, containing an element (ORE) shown by mutagenesis to be required for oxygen regulation, leads to the ques- tion of what factor binds to this element and how it mediates this response. The use of nuclear extract obtained from H460 cells grown under normoxia or hypoxia did not show differences in ORE–OREF bind- ing, indicating that the amount of OREF does not change as a function of the oxygen concentration. Pos- sibly, the interaction of OREF with other factors is modified as a function of the oxygen concentration. If OREF is not the oxygen sensor, but a downstream factor of the actual oxygen sensor, OREF could be A B Fig. 4. (A) SDS-PAGE of isolated CcO from cow lung in comparison with liver CcO. CcO samples from liver and lung were isolated side-by-side and applied to SDS-PAGE. Lane M, molecular size mar- ker; lanes 1 and 2, 37% and 45% ammonium sulfate-precipitated lung CcO; lane 3, 45% ammonium sulfate-precipitated cow liver CcO. (B) Respiration kinetics of solubilized cow lung CcO in com- parison with liver CcO. CcO activity was measured with the polaro- graphic method at 25 °C by increasing the amount of substrate cytochrome c. CcO activity (TN, turnover number) is defined as the amount of O 2 consumed (lmol) per second per amount of CcO (lmol). The data shown were obtained with the 45% ammonium sulfate-precipitated fractions. CcO activity was analyzed in a closed 200 lL chamber containing a micro-Clark-type oxygen electrode (Oxygraph system, Hansatech). Representative data from a total of four independent experiments are shown. Cytochrome c oxidase subunit IV-2 hypoxic response M. Hu ¨ ttemann et al. 5744 FEBS Journal 274 (2007) 5737–5748 ª 2007 The Authors Journal compilation ª 2007 FEBS targeted for phosphorylation, altering its interaction with other factors involved in complex formation. As several Sp1-like sites are present in the CcO4-2 pro- moter, indirect regulation is possible, involving modifi- cations that modulate the potential OREF–Sp1 interaction, such as Sp1 phosphorylation [24]. In lower organisms there are two examples of oxygen- mediated CcO isoform gene expression. In yeast, there are isoforms of subunit 5, called 5a and 5b, which are expressed under normoxia and hypoxia, respectively, and have been proposed to be analogous to mamma- lian CcO subunit 4 [25]. However, mammalian CcO4- 1 ⁄ 2 and yeast CcO5a ⁄ b do not share any homology at the protein level. In the slime mold Dictyostelium dis- coideum, there is an isoform pair of CcO subunit 7. Here, CcO7e, which is expressed under normoxic con- ditions, is replaced by CcO7s under hypoxia, and this switching is mediated by an oxygen-dependent tran- scriptional element located in the short intergenic region between the two adjacent genes [26]. Analysis of the yeast and Dictyostelium CcO hypoxia-regulated promoters revealed that the mammalian ORE sequence is absent in both organisms, which agrees with our functional model that the expression of CcO4-2 repre- sents a unique protective adaptation found in the highly oxygenated respiratory system in higher organ- isms, rather than being an adaptation to very low oxy- gen levels, under which yeast CcO5b and Dictyostelium CcO7s are expressed. Experimental procedures Cell lines and reagents Human lung adenocarcinoma-derived cell line H460 was grown in RMPI 1640 medium (Gibco BRL, Carlsbad, CA, USA) containing 0.1% glucose supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin in a 5% CO 2 atmosphere. Parallel experiments involving varying O 2 concentrations were performed in a hypoxic chamber under the control of ProOx 110 oxygen and ProCO 2 carbon dioxide controllers (BioSperix, Redfield, NY, USA). Media were supplemented with 50 mgÆmL )1 uridine and 110 mgÆmL )1 pyruvate in experiments performed at 0% oxygen [27]. HeLa cells were grown in DMEM (Gibco BRL) containing 0.1% glucose supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin. RNA isolation and quantitative PCR Lung, heart, small intestine, aorta and trachea RNA isola- tions and quantitative PCR with specific primers for CcO4- 2 and CcO4-1 were performed as described previously [5]. Cloning of the promoter regions with a novel method: ‘one-way PCR’ (Fig. 1A) In order to amplify the unknown CcO4-2 5¢-genomic pro- moter region from cow, mouse and rat, we developed a novel method, which is an extension of 5¢-rapid amplifica- tion of cDNA ends (5¢-RACE) used to generate 5¢-cDNAs [28]. This approach utilizes a dT 17 -oligonucleotide (Q T pri- mer) which contains an appended sequence that allows the use of specific primers (Q inner and Q outer ) in subsequent PCRs. Genomic DNA, isolated from muscle tissue of all species using the Wizard Genomic DNA Isolation Kit (Pro- mega, Madison, WI, USA), was used as template instead of RNA in the RACE protocol. Three primers directed to the unknown 5¢-region (P-1 cow , P-2 cow , P-3 cow , P-1 rat , P-2 rat , P-3 rat , P-1 mouse , P-2 mouse and P-3 mouse ) were derived from known cDNA exon I (cow and rat) or intron I (mouse) sequences [5]. In a first linear PCR amplification, the outer- most primer P-1 was used without a counter primer in a 50 lL PCR for each species employing the Expand Long Template PCR System (Roche, Indianapolis, IN, USA) in combination with the kit’s buffer 3 and a 0.5 mm final con- centration of each dNTP. Initial denaturation at 93 °C for 2 min was followed by 5 s at 93 °C, 30 s at 65 °C and 2 min at 68 °C, with 30 cycles in total. Buffer components and dNTPs were removed from the mix, a poly(A) tail was appended to the single-stranded DNA (equivalent to the cDNA first strands in the 5¢-RACE method) and 5 lL (of 25 lL) of the previous reaction was used to anneal the Q T primer and for the extension reaction, as described previ- ously [29]. Primers P-2 and Q outer (15 pm each) were added to the mixture, and the outer PCR was performed with an initial denaturation at 93 °C for 1 min, followed by 30 s at 93 °C, 30 s at 58 °C and 2 min at 72 °C, with 30 cycles in total. A 50 lL nested PCR was then carried out with prim- ers P-3 and Q inner , and 1 lL of a 1 : 30 dilution of the pre- vious reaction as template, using similar conditions as in the outer PCR (summarized in Fig. 1A). The amplifications yielded a smeary size distribution on agarose gel electro- phoresis, ranging from 500 bp to 3 kb, because of the absence of a counter primer in the initial linear amplifica- tion reaction. DNA between 1 and 2 kb was cut out of the gel and purified using the Nucleotrap Gel Extraction Kit (Clontech, Mountain View, CA, USA). DNA fragments were cloned and sequenced as described previously [5]. Reporter gene constructs A 2.8-kb genomic fragment of the human CcO4-2 promoter, including exon I, was amplified from human genomic DNA with primers P promoter-forward and P promoter-reverse in a 50 lL touchdown PCR () 1 °C ⁄ cycle), with denaturation for 35 s at 94 °C, annealing for 30 s at 63–58 °C, extension for 4 min at 70 ° C, and 32 cycles in total, using the Expand M. Hu ¨ ttemann et al. Cytochrome c oxidase subunit IV-2 hypoxic response FEBS Journal 274 (2007) 5737–5748 ª 2007 The Authors Journal compilation ª 2007 FEBS 5745 High Fidelity PCR System (Roche). Seven different-sized promoter fragments (2646, 579, 399, 293, 203, 118, 76 bp, all including 56 bp of exon I) were generated in separate nested PCRs using 1 lL of a 1 : 40 dilution of the previous PCR as template and primers P prom +1,2,3,4,5,6,7 in combi- nation with P promreverse under similar touchdown conditions. All P prom primers contained a XhoI5¢-adapter sequence AG- TCTATTCTCGAG (Table 1). Fragments were gel-purified (see above), digested with XhoI (Promega) and gel-purified once more. The longest fragment was only partially digested as it contained an internal XhoI site. The pGL3basic lucifer- ase reporter vector (Promega) was digested with XhoI, dephosphorylated with shrimp alkaline phosphatase (Roche) and used for ligation of the seven promoter fragments. Cor- rect orientation of individual clones was tested by PCR, and positive clones were verified by sequencing. The HIF-1a construct was a kind gift from Dr Navdeep Chandel (Northwestern University, Evanston, IL, USA). It contains three copies of the 5¢-RCGTG-3¢ motif in front of the luciferase gene in the pGL2 reporter vector (Promega). A promoterless reporter gene vector was generated by removing the SV40 promoter from the pGL2 Promoter vec- tor (Promega) via a HindIII ⁄ XhoI double digestion. The vector fragment lacking the SV40 promoter was purified as above, DNA ends were filled using Pfu polymerase (Strata- gene, La Jolla, CA, USA) and the vector was treated with shrimp alkaline phosphatase (Roche). The ORE-containing sequence 5¢-GGACGTTCCCACGCTGG-3¢ and the mutated sequence 5¢-GGTCGTAACCACGCTGG-3¢ were cloned into the vector in various configurations and confirmed by sequencing. Site-directed mutagenesis The 579-bp promoter construct was used for the generation of all further constructs. Primers P ORE mut ,P Sp1 distal mut , P Sp1 middle mut and P Sp1 proximal mut (Table 1) were used for site-directed mutagenesis with the GeneEditor site-directed mutagenesis kit (Promega), according to the supplier’s pro- tocol. Transfection and luciferase assay H460 cells were plated onto 24-well plates at 4 · 10 4 cells ⁄ well and grown overnight. Cells were transfected using TransFast (Promega) with 1 lg of the promoter firefly lucif- erase construct and 0.04 lg of the pRL-SV40 control vector (Promega), which contains the Renilla luciferase cDNA downstream of the SV40 promoter. Cells were harvested 40 h after transfection and both luciferase activities were analyzed with the Dual-Luciferase Reporter Assay System (Promega), according to the supplier’s protocol, with an Optocomp 1 luminometer (MGM Instruments, Sparks, NV, USA). At least four replicates were performed for each. Preparation of nuclear extract and EMSA Nuclear protein extracts were prepared from H460 cells as described previously [30], HeLa nuclear extracts were pur- chased from Promega and protein concentrations were determined using the Bradford assay (Bio-Rad, Hercules, CA, USA). The oligonucleotide primers P ORE ,P ORE mut , P Sp1 ,P Sp1 mut ,P Sp1 19bp ,P Sp1 19bp mut and Punspecific com- petitor, and the 15 primer mixes containing mutations in each position of the core ORE sequence (see Fig. 3C), together with their reversed and complemented primers, were heated to 85 °C and slowly cooled to room tempera- ture in annealing buffer (10 mm MgCl 2 ,50mm NaCl, 20 mm Tris ⁄ Cl, pH 7.5). [c- 32 P]-labelling of double- stranded oligonucleotides, their purification and subsequent nuclear extract binding reactions were carried out as described previously [31]. The DNA-bound complexes were Table 1. Sequences of oligonucleotides used in RACE, ‘one-way PCR’, site-directed mutagenesis and EMSA. Primer ID Sequence (5’- to 3’) P-1 cow TCTTGCGGCTTGGAGAGAGCCAG P-2 cow CCAGAACGCGACCCAGGTC P-3 cow CAGGTCTGCAGAGCAAGCAACAG P-1 rat TAGTTGCAAGCTGAAGACCG P-2 rat GCTGAAGACCGCGGAGGTAC P-3 rat GAGGTACCCAGAACTGCCCTG P-1 mouse GATAGTCAGTGGGGGAAACCTCAG P-2 mouse CAGCAAAAGAGGGCTGTGTGGTG P-3 mouse TGGCCGCCACGAACATCCCATC P promoter forward GTTGCCCAGGTTGGAGTGCAG P promoter reverse CTCGCGGGCTCGGCAGTGGGAG P prom+1 AGTCTATTCTCGAGCACCTGGGACTACAGG P prom+2 AGTCTATTCTCGAGCCCAAAGCGCTGAGATTACAG P prom+3 AGTCTATTCTCGAGATGCTTCTGGAGTAGGAGGCA P prom+4 AGTCTATTCTCGAGGTGTGGAGGAGGCAGGGAGAC P prom+5 AGTCTATTCTCGAGGAGGCGCTCTGCAGTGCCTC P prom+6 AGTCTATTCTCGAGAAGCAGGACGTTCCCACGCTG P prom+7 AGTCTATTCTCGAGGGGGCGGGCGCCCGCACTCAG P promreverse AGTCTATTCTCGAGCGCGACCTGGGTCTGCCCAG P ORE mut GGCCGCCCCAGCGTGGTTACGACCTGCTTCGGCAGG GCGTGG P Sp1 distal mut GCCTTTCTCGGGGCCGCTTCAGCGTGGGAACG P Sp1 middle mut GGCGCCCGCCCCCGGCCATACCACAGCCTTTCTCGG P Sp1 proximal mut GCGGGCGCCCGAACCCTGCCCGCCCCACA P intron IIIfoward ATATTCTAGGATCCTGGCTCATTCACTGCTGTCAC P intron IIIreverse ATATTCTAGGATCCCGGCTTCCCCCTCCCTGCAG P HIF-1a mut GCAAATTCTTACTGAGCTTTTACTATATGCACAGC P ORE GGACGTTCCCACGCTGGGG P ORE mut GGTCGTAACCACGCTGGGG P Sp1 GGCTGTGGGGCGGGCCGG P Sp1 mut GGCTGTGGGTATGGCCGG P Sp1 19bp TTCGATCGGGGCGGGGCGA P Sp1 19bp mut TTCGATCGGTTCGGGGCGA P unspecific competitor CTAGCAANNATNNTTGCTAG Cytochrome c oxidase subunit IV-2 hypoxic response M. Hu ¨ ttemann et al. 5746 FEBS Journal 274 (2007) 5737–5748 ª 2007 The Authors Journal compilation ª 2007 FEBS [...]... control of respiration by cytochrome c oxidase in wild-type and mitochondrial DNA mutation-carrying human cells Proc Natl Acad Sci USA 94, 1166–1171 22 Chandel NS, Maltepe E, Goldwasser E, Mathieu CE, Simon MC & Schumacker PT (1998) Mitochondrial 5748 23 24 25 26 27 28 29 30 31 reactive oxygen species trigger hypoxia-induced transcription Proc Natl Acad Sci USA 95, 11 715–11 720 Arnold S & Kadenbach... transcription pattern of subunit isoforms and the kinetics of cytochrome c oxidase in cortical astrocytes and cerebellar neurons J Neurochem 99, 937–951 16 Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV, Ignatieva EV, Ananko EA, Podkolodnaya OA, Kolpakov FA et al (1998) Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL Nucleic Acids Res 26, 362–367 17 Lee I, Salomon AR,... was analyzed in a closed 200 lL chamber containing a micro-Clark-type oxygen electrode (Oxygraph system, Hansatech, Kings Lynn, UK) Measurements were carried out using 250 nm CcO at 25 C after the addition of ascorbic acid (20 mm) and increasing amounts of Cyt c from 0 to 30 lm Oxygen consumption was recorded on a computer and analyzed with Oxygraph software The turnover number is defined as the amount... background signal Isolation of CcO and enzymatic activity measurements CcO was isolated from cow lung and liver under standard conditions as described previously [17] Three micromolar CcO was dialyzed in the presence of 0.1 mm ATP and 120 lm cardiolipin to remove cholate and to replace potentially damaged cardiolipin, in 10 mm K-Hepes (pH 7.4), 40 mm KCl, 1% Tween 20, 2 mm EGTA and 10 mm KF CcO activity... Antibodies Sp1 ( 1C6 ), Sp3 (D20), Sp4 (V-20), HIF- 1a (H-206), CBP (451), Ikaros (E-20), c- Rel (B-6), and normal rabbit IgG as control, were obtained from Santa Cruz Biotech (Santa Cruz, CA, USA) Quantification of EMSA bands After the gels had been scanned as described above, the intensities of individual bands were analysed with imagequant software (version 5, Molecular Dynamics) and corrected for background... R, Vettore S, Aratri E & Sandona D (1997) Subunit change in cytochrome c oxidase: identification of the oxygen switch in Dictyostelium Embo J 16, 739– 749 King MP & Attardi G (1989) Human cells lacking mtDNA: repopulation with exogenous mitochondria by complementation Science 246, 500–503 Frohman MA (1995) Rapid amplification of cDNA ends In PCR Primer, a Laboratory Manual (Dieffenbach CW & Dveksler... Michelakis ED, Hampl V, Nsair A, Wu X, Harry G, Haromy A, Gurtu R & Archer SL (2002) Diversity in mitochondrial function explains differences in vascular oxygen sensing Circ Res 90, 1307–1315 20 Villani G, Greco M, Papa S & Attardi G (1998) Low reserve of cytochrome c oxidase capacity in vivo in the respiratory chain of a variety of human cell types J Biol Chem 273, 31 829–31 836 21 Villani G & Attardi... Ficarro S, Mathes I, Lottspeich F, Grossman LI & Huttemann M (2005) cAMP-dependent ¨ tyrosine phosphorylation of subunit I inhibits cytochrome c oxidase activity J Biol Chem 280, 6094–6100 18 Waypa GB, Marks JD, Mack MM, Boriboun C, Mungai PT & Schumacker PT (2002) Mitochondrial reactive oxygen species trigger calcium increases during hypoxia in pulmonary arterial myocytes Circ Res 91, 719–726 19 Michelakis... Mammalian subunit IV isoforms of cytochrome c oxidase Gene 267, 111–123 6 Fukuda R, Zhang H, Kim JW, Shimoda L, Dang CV & Semenza GL (2007) HIF-1 regulates cytochrome oxidase subunits to optimize efficiency of respiration in hypoxic cells Cell 129, 111–122 7 Zhang H, Gao P, Fukuda R, Kumar G, Krishnamachary B, Zeller KI, Dang CV & Semenza GL (2007) HIF-1 inhibits mitochondrial biogenesis and cellular respiration... respiration in VHL-deficient renal cell carcinoma by repression of C- MYC activity Cancer Cell 11, 407–420 8 Semenza GL (2007) HIF-1 mediates the Warburg effect in clear cell renal carcinoma J Bioenerg Biomembr doi:10.1007/s10863-007-9081-2 9 Kim JW, Tchernyshyov I, Semenza GL & Dang CV (2006) HIF-1-mediated expression of pyruvate dehydrogenase kinase: a metabolic switch required for cellular adaptation . Sequence (5’- to 3’) P-1 cow TCTTGCGGCTTGGAGAGAGCCAG P-2 cow CCAGAACGCGACCCAGGTC P-3 cow CAGGTCTGCAGAGCAAGCAACAG P-1 rat TAGTTGCAAGCTGAAGACCG P-2 rat GCTGAAGACCGCGGAGGTAC P-3 rat GAGGTACCCAGAACTGCCCTG P-1 mouse GATAGTCAGTGGGGGAAACCTCAG P-2 mouse CAGCAAAAGAGGGCTGTGTGGTG P-3 mouse TGGCCGCCACGAACATCCCATC P promoter. reverse CTCGCGGGCTCGGCAGTGGGAG P prom+1 AGTCTATTCTCGAGCACCTGGGACTACAGG P prom+2 AGTCTATTCTCGAGCCCAAAGCGCTGAGATTACAG P prom+3 AGTCTATTCTCGAGATGCTTCTGGAGTAGGAGGCA P prom+4 AGTCTATTCTCGAGGTGTGGAGGAGGCAGGGAGAC P prom+5 AGTCTATTCTCGAGGAGGCGCTCTGCAGTGCCTC P prom+6 AGTCTATTCTCGAGAAGCAGGACGTTCCCACGCTG P prom+7 AGTCTATTCTCGAGGGGGCGGGCGCCCGCACTCAG P promreverse AGTCTATTCTCGAGCGCGACCTGGGTCTGCCCAG P ORE mut GGCCGCCCCAGCGTGGTTACGACCTGCTTCGGCAGG GCGTGG P Sp1. IIIfoward ATATTCTAGGATCCTGGCTCATTCACTGCTGTCAC P intron IIIreverse ATATTCTAGGATCCCGGCTTCCCCCTCCCTGCAG P HIF- 1a mut GCAAATTCTTACTGAGCTTTTACTATATGCACAGC P ORE GGACGTTCCCACGCTGGGG P ORE mut GGTCGTAACCACGCTGGGG P Sp1 GGCTGTGGGGCGGGCCGG P Sp1