Báo cáo khoa học: Transcription of mammalian cytochrome c oxidase subunit IV-2 is controlled by a novel conserved oxygen responsive element pptx

... proximal mutGCGGGCGCCCGAACCCTGCCCGCCCCACAPintron IIIfowardATATTCTAGGATCCTGGCTCATTCACTGCTGTCACPintron IIIreverseATATTCTAGGATCCCGGCTTCCCCCTCCCTGCAGPHIF- 1a mutGCAAATTCTTACTGAGCTTTTACTATATGCACAGCPOREGGACGTTCCCACGCTGGGGPORE ... reverseCTCGCGGGCTCGGCAGTGGGAGPprom+1AGTCTATTCTCGAGCACCTGGGACTACAGGPprom+2AGTCTATTCTCGAGCCCAAAGCGCTGAGATTACAGPprom+3AGTCTATTCTCGAGATGCTTCTGGAGTAGGAGGCAPprom+4AGTCTATTCTCGAGGTGTGGAGGAGGCAGGGAGACPprom+5AGTCTATTCTCGAGGAGGCGCTCTGCAGTGCCTCPprom+6AGTCTATTCTCGAGAAGCAGGACGTTCCCACGCTGPprom+7AGTCTATTCTCGAGGGGGCGGGCGCCCGCACTCAGPpromreverseAGTCTATTCTCGAGCGCGACCTGGGTCTGCCCAGPORE mutGGCCGCCCCAGCGTGGTTACGACCTGCTTCGGCAGGGCGTGGPSp1 distal mutGCCTTTCTCGGGGCCGCTTCAGCGTGGGAACGPSp1 middle mutGGCGCCCGCCCCCGGCCATACCACAGCCTTTCTCGGPSp1 ... 3’)P-1cowTCTTGCGGCTTGGAGAGAGCCAGP-2cowCCAGAACGCGACCCAGGTCP-3cowCAGGTCTGCAGAGCAAGCAACAGP-1ratTAGTTGCAAGCTGAAGACCGP-2ratGCTGAAGACCGCGGAGGTACP-3ratGAGGTACCCAGAACTGCCCTGP-1mouseGATAGTCAGTGGGGGAAACCTCAGP-2mouseCAGCAAAAGAGGGCTGTGTGGTGP-3mouseTGGCCGCCACGAACATCCCATCPpromoter forwardGTTGCCCAGGTTGGAGTGCAGPpromoter...

Báo cáo khoa học: Optimization of D-amino acid oxidase for low substrate concentrations – towards a cancer enzyme therapy pdf

... the application of a directed evolution approach to obtain yeast DAAOvariants with substantially increased activity at low O2and d -amino acid concentrations. This could lead tobetter efﬁcacy ... cytotoxicity of DAAO was assessed by the thiazolylblue tetrazolium bromide assay [36] on mouse CT26 (coloncarcinoma), 4T1 (mammary gland), N 2C (mammary gland)and TSA (mammary adenocarcinoma) and ... H2O2inducesapoptosis of tumor cells in vitro via activation of thecaspase cascade [7,8]. The use of ROS-generatingenzymes such as xanthine oxidase and glucose oxidase as anticancer agents has been reported...

Tài liệu Báo cáo khoa học: Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation doc

... VIC, Australia), containing N-terminally ﬂag-tagged human Salvador (hSav) cDNA was a kind gift fromD Haber (MGH Cancer Center, Charlestown, MA, USA).J Chernoff (Fox Chase Cancer Center, Philadelphia, ... purchased fromRoche (Kew, VIC, Australia) and for immunoprecipita-tions, rabbit polyclonal anti-HA (HA.11) antisera waspurchased from Covance (Berkeley, CA, USA). Mousemonoclonal antimyc (9E10) ... Ura S, Masuyama N, Graves JD & Gotoh Y (2001)Caspase cleavage of MST1 promotes nuclear transloca-tion and chromatin condensation. Proc Natl Acad SciUSA 98, 10148–10153.10 Lin Y, Khokhlatchev...

Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf

... or com-pletely shut off. By contrast, when there is demand forlarge excesses of a particular type of tRNA, as in thePSG, and sufﬁcient quantities of transcription factorsare available, transcription ... properties.Proc Natl Acad Sci USA 88, 7308–7312.8 Bartholomew B, Kassavetis GA & Geiduschek EP (1991)Two components of Saccharomyces cerevisiae transcrip-tion factor IIIB (TFIIIB) are stereospeciﬁcally ... 12-O-tetradecanoylphorbol-13-acetate(TPA) is mediated by transcription factor IIIB. Mol CellBiol 14, 339–347.36 Palida FA, Hale C & Sprague KU (1993) Transcription of a silkworm tRNA (cAla)...

Báo cáo khoa học: Control of mammalian gene expression by amino acids, especially glutamine potx

... Parry L, Deval C, Chambon C, Fafour-noux P & Bruhat A (2007) The p300/CBP-associatedfactor (PCAF) is a cofactor of ATF4 for amino acid-regulated transcription of CHOP. Nucleic Acids Res35, ... Functional activity of hepatocytenuclear factor-1 is speciﬁcally decreased in amino acid-limited hepatoma cells. Biochim Biophys Acta 1447,160–174.39 Cai Y, Zhang C, Nawa T, Aso T, Tanaka ... such as the basic-leucinezipper factors, activating transcription factors and CCAAT/enhancer-bind-ing protein, as well as speci c regulatory sequences, such as amino acidresponse element and...

Báo cáo khoa học: Binding of the volatile general anesthetics halothane and isoﬂurane to a mammalian b-barrel protein doc

... binding of halothane and isoﬂurane were characterized thermodynamically using iso-thermal titration calorimetry. Hydrogen exchange was used to evaluate theeffects of bound halothane and isoﬂurane ... shows that halothane can displace AMA fromthe porcine odorant binding protein cavity. Thecompetition curve was treated as a two parameterhyperbolic decay (R ¼ 0.97) and gave an EC50 of 0.86 ... Biotecnologie Veterinarie, Qualita`e Sicurezza degli Alimenti, Universita`di Parma, Parma, Italy A molecular understanding of volatile anestheticmechanisms of action will require structural...

Báo cáo khoa học: Dimerization of mammalian adenylate cyclases Functional, biochemical and ¯uorescence resonance energy transfer (FRET) studies pot

... differentisoforms of adenylate cyclase. Consequently, cells weretransfected with combinations of inactive or active AC8and active or inactive AC5 and AC6 cDNAs. The inactiveAC8, AC8D582)594, also ... higherorder assembly of adenylate cyclases. Mammalian adenylatecyclases are in the family of ATP-binding cassette (ABC)transporters and share their overall structure [8] which, by analogy, further raises ... adenylate cyclase. A substantial body of evidencealready shows that Ca2+-sensitive adenylate cyclases andCCE channels are intimately colocalized, with the result thatonly Ca2+entering via CCE...

Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf

... uptake of satu-rated and unsaturated FFAs into the cells. After theirinternalization, FFAs are converted to fatty acyl-CoA, a reaction catalyzed by ACS. Fatty acyl-CoAs are acti-vated forms of ... theappearance of cytochrome c in the cytosol (Fig. 2F),which are clear characteristics of mitochondrial-medi-ated apoptotic cell death. In all cases, oleate was nottoxic by itself, and its coadministration ... monounsaturated long-chain fatty acids in pan-creatic beta-cells. J Endocrinol 194, 283–291.16 Cunha DA, Hekerman P, Ladriere L, Bazarra-Castro A, Ortis F, Wakeham MC, Moore F, Rasschaert J,Cardozo...

Tài liệu Báo cáo khoa học: Binding of N- and C-terminal anti-prion protein antibodies generates distinct phenotypes of cellular prion proteins (PrPC) obtained from human, sheep, cattle and mouse doc

... spongiform encephalopathy of cattle [1,2]. Scrapie is the prion disease in sheep andgoats.The main characteristic of the disease is the accumu-lation of an abnormal prion protein (PrPSc), thoughtto ... cytoplasmic membraneanchorage [17]. The structure is characterized by anN-terminal domain including octapeptide repeats, a central hydrophobic domain and a C- terminal regionwith two asparagine-linked ... Characterization of BSE and scrapie strains ⁄ isolates. Arch Virol Suppl 16,217–226.8 Gambetti P, Kong Q, Zou W, Parchi P & Chen SG(2003) Sporadic and familial CJD: classiﬁcation andcharacterisation....

Báo cáo khoa học: Binding of cGMP to the transducin-activated cGMP phosphodiesterase, PDE6, initiates a large conformational change involved in its deactivation ppt

... 34284–34292.35 Yamazaki A, Yu H, Yamazaki M, Honkawa H, Matsu-ura I, Usukura J & Yamazaki RK (2003) A critical rolefor ATP in the stimulation of retinal guanylyl cyclase by guanylyl cyclase-activating ... during Pabcc activationto Pabc and during Pabc deactivation to Pabcc.First, we investigate whether cGMP binds to Pabcduring the activation of Pabcc to Pabc. After incuba-tion of OS homogenates ... [20]. Comparison of the [3H]cGMP-binding activity of cone PDE with that of Pabc is discussed later.Contents of cGMP in Pabcc and PabcPabcc and Pabc were puriﬁed from GTPcS-treated OShomogenates...

Xem thêm