Báo cáo khoa học: Transcription of mammalian cytochrome c oxidase subunit IV-2 is controlled by a novel conserved oxygen responsive element pptx
Báo cáo khoa học: Transcription of mammalian cytochrome c oxidase subunit IV-2 is controlled by a novel conserved oxygen responsive element pptx
... proximal mut GCGGGCGCCCGAACCCTGCCCGCCCCACA P intron IIIfoward ATATTCTAGGATCCTGGCTCATTCACTGCTGTCAC P intron IIIreverse ATATTCTAGGATCCCGGCTTCCCCCTCCCTGCAG P HIF- 1a mut GCAAATTCTTACTGAGCTTTTACTATATGCACAGC P ORE GGACGTTCCCACGCTGGGG P ORE ... reverse CTCGCGGGCTCGGCAGTGGGAG P prom+1 AGTCTATTCTCGAGCACCTGGGACTACAGG P prom+2 AGTCTATTCTCGAGCCCAAAGCGCTGAGATTACAG P prom+3 AGTCTATTCTCGAGATGCTTCTGGAGTAGG...
Ngày tải lên: 30/03/2014, 03:20
Báo cáo khoa học: Optimization of D-amino acid oxidase for low substrate concentrations – towards a cancer enzyme therapy pdf
... the application of a directed evolution approach to obtain yeast DAAO variants with substantially increased activity at low O 2 and d -amino acid concentrations. This could lead to better efficacy ... cytotoxicity of DAAO was assessed by the thiazolyl blue tetrazolium bromide assay [36] on mouse CT26 (colon carcinoma), 4T1 (mammary gland), N 2C (mammary gland) and TSA (mammary adenoca...
Ngày tải lên: 16/03/2014, 02:20
Tài liệu Báo cáo khoa học: Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation doc
... VIC, Australia), containing N-terminally flag- tagged human Salvador (hSav) cDNA was a kind gift from D Haber (MGH Cancer Center, Charlestown, MA, USA). J Chernoff (Fox Chase Cancer Center, Philadelphia, ... purchased from Roche (Kew, VIC, Australia) and for immunoprecipita- tions, rabbit polyclonal anti-HA (HA.11) antisera was purchased from Covance (Berkeley, CA, USA). Mouse monoclonal ant...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf
... or com- pletely shut off. By contrast, when there is demand for large excesses of a particular type of tRNA, as in the PSG, and sufficient quantities of transcription factors are available, transcription ... properties. Proc Natl Acad Sci USA 88, 7308–7312. 8 Bartholomew B, Kassavetis GA & Geiduschek EP (1991) Two components of Saccharomyces cerevisiae transcrip- tion fac...
Ngày tải lên: 20/02/2014, 02:21
Báo cáo khoa học: Control of mammalian gene expression by amino acids, especially glutamine potx
... Parry L, Deval C, Chambon C, Fafour- noux P & Bruhat A (2007) The p300/CBP-associated factor (PCAF) is a cofactor of ATF4 for amino acid- regulated transcription of CHOP. Nucleic Acids Res 35, ... Functional activity of hepatocyte nuclear factor-1 is specifically decreased in amino acid- limited hepatoma cells. Biochim Biophys Acta 1447, 160–174. 39 Cai Y, Zhang C, Nawa...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Binding of the volatile general anesthetics halothane and isoflurane to a mammalian b-barrel protein doc
... binding of halothane and isoflurane were characterized thermodynamically using iso- thermal titration calorimetry. Hydrogen exchange was used to evaluate the effects of bound halothane and isoflurane ... shows that halothane can displace AMA from the porcine odorant binding protein cavity. The competition curve was treated as a two parameter hyperbolic decay (R ¼ 0.97) and gave an EC 50...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Dimerization of mammalian adenylate cyclases Functional, biochemical and ¯uorescence resonance energy transfer (FRET) studies pot
... different isoforms of adenylate cyclase. Consequently, cells were transfected with combinations of inactive or active AC8 and active or inactive AC5 and AC6 cDNAs. The inactive AC8, AC8 D582)594 , also ... higher order assembly of adenylate cyclases. Mammalian adenylate cyclases are in the family of ATP-binding cassette (ABC) transporters and share their overall structure [8] which,...
Ngày tải lên: 23/03/2014, 21:21
Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf
... uptake of satu- rated and unsaturated FFAs into the cells. After their internalization, FFAs are converted to fatty acyl-CoA, a reaction catalyzed by ACS. Fatty acyl-CoAs are acti- vated forms of ... the appearance of cytochrome c in the cytosol (Fig. 2F), which are clear characteristics of mitochondrial-medi- ated apoptotic cell death. In all cases, oleate was not toxic by...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: Binding of N- and C-terminal anti-prion protein antibodies generates distinct phenotypes of cellular prion proteins (PrPC) obtained from human, sheep, cattle and mouse doc
... spongiform encephalopathy of cattle [1,2]. Scrapie is the prion disease in sheep and goats. The main characteristic of the disease is the accumu- lation of an abnormal prion protein (PrP Sc ), thought to ... cytoplasmic membrane anchorage [17]. The structure is characterized by an N-terminal domain including octapeptide repeats, a central hydrophobic domain and a C- termina...
Ngày tải lên: 19/02/2014, 02:20
Báo cáo khoa học: Binding of cGMP to the transducin-activated cGMP phosphodiesterase, PDE6, initiates a large conformational change involved in its deactivation ppt
... 34284– 34292. 35 Yamazaki A, Yu H, Yamazaki M, Honkawa H, Matsu- ura I, Usukura J & Yamazaki RK (2003) A critical role for ATP in the stimulation of retinal guanylyl cyclase by guanylyl cyclase-activating ... during Pabcc activation to Pabc and during Pabc deactivation to Pabcc. First, we investigate whether cGMP binds to Pabc during the activation of Pabcc to Pabc. After incuba-...
Ngày tải lên: 06/03/2014, 00:21