Báo cáo khoa học: Paralog of the formylglycine-generating enzyme – retention in the endoplasmic reticulum by canonical and noncanonical signals pptx

Paralog of the formylglycine-generating enzyme – retention in the endoplasmic reticulum by canonical and noncanonical signals Santosh Lakshmi Gande 1 , Malaiyalam Mariappan 1 , Bernhard Schmidt 1 , Thomas H. Pringle 2 , Kurt von Figura 1 and Thomas Dierks 3 1 Zentrum fu ¨ r Biochemie und Molekulare Zellbiologie, Abteilung Biochemie II, Universita ¨ tGo ¨ ttingen, Germany 2 Sperling Foundation, Eugene, OR, USA 3 Fakulta ¨ tfu ¨ r Chemie, Biochemie I, Universita ¨ t Bielefeld, Germany In the catalytic center of eukaryotic and prokaryotic sulfatases, a unique amino acid, C a -formylglycine (FGly), can be found that is essential for enzymatic activity [1–5]. The FGly participates as an aldehyde hydrate in the hydrolysis of sulfate esters according to a novel trans-sulfation ⁄ elimination mechanism [5–9]. The FGly in all eukaryotic and in most prokaryotic sulfatases is post-translationally generated by oxidation of a specific cysteine residue and, in most cases, this oxidation is catalyzed by the recently discovered form- ylglycine-generating enzyme (FGE), a novel oxygenase with unusual structural and catalytic properties [10–15]. The genetic defect of FGE in human leads to multiple sulfatase deficiency, a rare inherited disorder Keywords endoplasmic reticulum; formylglycine- generating enzyme; KDEL receptor; protein retention; SUMF2 Correspondence T. Dierks, Fakulta ¨ tfu ¨ r Chemie, Biochemie I, Universita ¨ t Bielefeld, Universita ¨ tsstr. 25, 33615 Bielefeld, Germany Fax: +49 521 106 6014 Tel: +49 521 106 2092 E-mail: thomas.dierks@uni-bielefeld.de Website: http://www.uni-bielefeld.de/ chemie/bc1/bc1.htm (Received 28 October 2007, revised 17 December 2007, accepted 4 January 2008) doi:10.1111/j.1742-4658.2008.06271.x Formylglycine-generating enzyme (FGE) catalyzes in newly synthesized sul- fatases the oxidation of a specific cysteine residue to formylglycine, which is the catalytic residue required for sulfate ester hydrolysis. This post-trans- lational modification occurs in the endoplasmic reticulum (ER), and is an essential step in the biogenesis of this enzyme family. A paralog of FGE (pFGE) also localizes to the ER. It shares many properties with FGE, but lacks formylglycine-generating activity. There is evidence that FGE and pFGE act in concert, possibly by forming complexes with sulfatases and one another. Here we show that human pFGE, but not FGE, is retained in the ER through its C-terminal tetrapeptide PGEL, a noncanonical variant of the classic KDEL ER-retention signal. Surprisingly, PGEL, although having two nonconsensus residues (PG), confers efficient ER retention when fused to a secretory protein. Inducible coexpression of pFGE at dif- ferent levels in FGE-expressing cells did not significantly influence the kinetics of FGE secretion, suggesting that pFGE is not a retention factor for FGE in vivo. PGEL is accessible at the surface of the pFGE structure. It is found in 21 mammalian species with available pFGE sequences. Other species carry either canonical signals (eight mammals and 26 nonmammals) or different noncanonical variants (six mammals and six nonmammals). Among the latter, SGEL was tested and found to also confer ER retention. Although evolutionarily conserved for mammalian pFGE, the PGEL signal is found only in one further human protein entering the ER. Its conse- quences for KDEL receptor-mediated ER retrieval and benefit for pFGE functionality remain to be fully resolved. Abbreviations ER, endoplasmic reticulum; FGE, C a -formylglycine-generating enzyme; FGly, C a -formylglycine; PDI, protein disulfide isomerase; pFGE, paralog of C a -formylglycine-generating enzyme. 1118 FEBS Journal 275 (2008) 1118–1130 ª 2008 The Authors Journal compilation ª 2008 FEBS of a fatal nature that is characterized by the synthesis of catalytically inactive sulfatases lacking FGly [12,13,16,17]. All multiple sulfatase deficiency patients analyzed so far carried mutations in the FGE-encoding SUMF1 gene [12,13,18–20]. In eukaryotes, a paralog gene (SUMF2) encoding a paralog of FGE (pFGE) can be traced back reliably via conserved sequence signatures to early deuterosto- mes [12,13,21–23], and indeed to lophotrochozoans, prebilaterans and even unicellular eukaryotes, although it appears to have been lost throughout certain large clades, such as arthropods (this work; see Results). Like FGE, pFGE localizes to the endoplasmic reticu- lum (ER), where FGly formation occurs in newly syn- thesized sulfatases [23,24]. FGE and pFGE show highly similar tissue-specific expression levels and share many structural properties [23–25]. However, pFGE lacks the enzymatic FGly-generating activity of FGE, as it lacks the two catalytic cysteines, Cys336 and Cys341, in the active site of FGE [23–25]. pFGE has a substrate-binding groove similar to FGE, and shows weak binding of sulfatase-derived synthetic peptides in vitro [23–25]. Also in vivo, pFGE seems to contact nascent sulfatases in the ER. Moreover, pFGE over- expression interferes with FGly formation, thereby counteracting FGE function [23,24]. The exact role of pFGE in this process and how this regulatory effect is brought about is presently under investigation. Several observations, including yeast two-hybrid and biochemical data, are in agreement with heterodimer formation of FGE and pFGE [23,24], and indeed, Zito et al. [24] have found multimeric complexes with and without sulfatases by coimmunoprecipitation. The structural pFGE dimer found in pFGE crystals and superposition with the FGE monomer suggests that heterodimer formation is feasible in a face-to-face manner with regard to the substrate-binding cleft [25]. Heterodimer formation could be stabilized by an unfolded sulfatase polypeptide, which might explain the regulatory function of pFGE. Alternatively, the inhibitory effect of pFGE observed on FGE function could be indirect, namely by competing for a common ER retention mechanism, thereby dislocating FGE from the ER. In fact, a small fraction of endogenous pFGE was found to be secreted, and upon overexpres- sion, pFGE could be detected in other cellular com- partments of the secretory pathway [23]. Therefore, the question arises of how pFGE and FGE are retained in the ER. Here we show that pFGE is retained via its C-terminal PGEL tetrapeptide sequence, which, like the classic KDEL signal, can act as an autonomous retrieval signal, most likely engag- ing a KDEL receptor (vertebrates have three paralo- gous KDELR genes), for retrieving pFGE from the cis-Golgi back to the ER. FGE lacks a signal even remotely resembling KDEL in mammals. However, pFGE overexpression shows no effect on FGE reten- tion. Results pFGE retention is mediated by a saturable mechanism A small fraction of endogenous pFGE can be detected extracellularly, whereas upon overexpression the recombinant pFGE is efficiently secreted [23]. To determine whether secretion of human pFGE is due to saturation of the retention ⁄ retrieval system, an induc- ible, human-derived expression system was established consisting of a Tet-On HT1080 fibrosarcoma cell line stably expressing the reverse tetracycline-controlled transactivator. These cells, upon transient transfection and doxycycline addition, allowed us to trigger pFGE expression at defined levels from a Tet-responsive pro- moter (see Experimental procedures). The transfected HT1080 cells were analyzed for intracellular and extra- cellular pFGE by western blotting using a polyclonal pFGE-specific antibody [23]. Extracellular pFGE is detected as a 32.5 ⁄ 31.5 kDa double band, due to heter- ogeneous processing of its N-glycan in the secretory pathway [23]. Treatment with up to 8 ngÆmL )1 doxycy- cline for 28 h led to expression of pFGE ranging from 0.34 to 6.1 lg of pFGE per mg of cell protein (Fig. 1). Analysis of cells and medium revealed that retention of pFGE was decreasing with increasing expression levels, with about 50% retention at the lowest and 12% retention at the highest expression level. This lat- ter value (about 10% of ‘retained’ protein) is likely to largely represent newly synthesized material on its way to the cell surface, because typically no more than 90% of total protein is found in the medium, even in the case of a native secretory protein (see below). This indicated that the mechanism used for pFGE retention is saturable. The C-terminus is involved in ER retention of pFGE In initial experiments, we had expressed human pFGE carrying a His 6 -tag at the C-terminus to facilitate detection and purification of pFGE. In these experi- ments, we noted that about 90% of the tagged pFGE was secreted [23]. To analyze a possible effect of the C-terminal His 6 -tag on retention ⁄ secretion of pFGE, tagged and untagged (wild-type) pFGE were S. L. Gande et al. ER retention by noncanonical retention signals FEBS Journal 275 (2008) 1118–1130 ª 2008 The Authors Journal compilation ª 2008 FEBS 1119 transiently expressed in HT1080 cells. When analyzed 24 h after transfection, His 6 -tagged pFGE was nearly quantitatively secreted (96% of total), whereas untag- ged pFGE was significantly retained inside the cells (26% retention) (Fig. 2). This cannot be explained by different expression levels, because the expression of intracellularly retained pFGE was two-fold higher than that of pFGE-His 6 . Thus, the C-terminal His 6 -tag impaired retention of pFGE, indicating that the C-ter- minus of pFGE might be involved in the ER retention mechanism. pFGE carries canonical or noncanonical ER retention signals in different species Inspection of the available pFGE protein sequences from 67 species (Fig. 3) revealed that 34 of these sequences contain a canonical ER retention signal of the KDEL type (basic-X-acidic-leucine) at the C-termi- nus, with the basic residue being lysine (21 species), arginine (nine) or histidine (four), and the acidic residue being glutamate (30) or aspartate (four). Mur- ine and rat pFGE carry the canonical KEDL motif, and the prototype KDEL can be found in orthologs from platypus, the snail Biomphalaria glabrata, the pla- narian Schmidtea mediterranea, and the sea anemone Nematostella vectensis. However, human pFGE and also pFGE from 20 further mammalian species (from various primates to squirrel, bat, dolphin, sloth and wallaby) carry a C-terminal PGEL tetrapeptide, i.e. lacking the critical basic residue in position 1 but with an acidic residue and a leucine in positions 3 and 4, typical for the KDEL retention signal (Fig. 3). More- over, there are further variants of the PGEL motif in pFGEs, such as FGEL (guinea pig), MGEL (hyrax), SGEL (opossum), PEEL (tree shrew, lemur), PREL (kangaroo rat), and PDEL (lamprey). With the excep- tion of the latter, these species, like all PGEL species, are mammals. It should be noted that both proline (or methionine and phenylalanine) in the first position and glycine in the second position do not fit with the gen- eral KDEL-like signal consensus [KRHQSA]-[DENQ]- E-L deposited in the PROSITE database [26]. The C-terminal PGEL and SGEL tetrapeptides function as retention signals for pFGE To look for a potential ER retention function of the C-terminal PGEL tetrapeptide of human pFGE, three mutant pFGE proteins were constructed with differ- ent C-termini. The PGEL tetrapeptide was either deleted (truncated pFGE) or substituted either by the canonical KDEL or by SGEL, one of the other non- canonical tetrapeptide sequences (see above). In sev- eral independent experiments, one of which is shown in Fig. 4A, truncated pFGE was mostly secreted, whereas the wild-type and the KDEL form were mostly retained. Also, the SGEL form showed Fig. 1. Retention of pFGE is mediated by a saturable mechanism. HT1080 cells stably expressing the reverse tetracycline-controlled trans- activator (Tet-On cells) were transiently transfected to express pFGE under control of a doxycycline-responsive promoter (see Experimental procedures). Six hours after transfection, pFGE expression was induced with 0.5–8 ngÆmL )1 doxycycline, as indicated. Twenty-eight hours after induction, pFGE was determined in cell lysates (C) and media (M) by western blotting. Note that the aliquots of cells and medium were loaded at a ratio of 10 : 1. The amount of total pFGE in cells and medium and the percentage of intracellular pFGE are given below the lanes. Two differentially glycosylated forms of pFGE (arrows) were detected in the medium (see text). Fig. 2. ER retention of pFGE is impaired by a C-terminal tag. pFGE and pFGE-His were transiently expressed in HT1080 cells. Twenty- four hours after transfection, aliquots of cells and medium (at a ratio of 10 : 1) were analyzed for pFGE by western blotting, using an antiserum against pFGE. The total expression level and the per- centage of intracellular pFGE are given. ER retention by noncanonical retention signals S. L. Gande et al. 1120 FEBS Journal 275 (2008) 1118–1130 ª 2008 The Authors Journal compilation ª 2008 FEBS — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — Fig. 3. Canonical and noncanonical ER retention signals in SUMF-encoded proteins. SUMF2-encoded pFGE and SUMF1-encoded FGE sequences were recovered from data- bases (see Experimental procedures; data- base mining freeze date August 2007) for 67 and 69 species, respectively. Species are given with their systematic and common names, and ordered according to the mod- ern phylogenetic tree (relative to human, subtrees not uniquely orderable). Sequences were aligned at their C-terminal regions to locate conserved pFGE-specific and FGE- specific anchors, respectively (see supple- mentary Figs S1 and S2). The last four encoded residues preceding the stop are indicated for all 67 pFGE C-termini. Species with canonical pFGE retention signals are colored in blue, and those with noncanonical pFGE signals in red (PGEL only) or green (other noncanonical). For species in black, no SUMF2 could be recovered; this may be explained (in some species but not all) by incomplete coverage of the genome. FGE C-termini are given for those 11 species having a KDEL-type signal; non-KDEL-like C-termini are indicated by four periods ( ). A dash (–) indicates that either no SUMF1 or no SUMF2 sequence could be recovered, as indicated. The presence of the three KDEL receptor genes is indicated by num- bers (123). KDELR1 is present in tetrapods from frog onwards, and KDELR3 in all tele- ost fish and tetrapods, but apparently not in chondrichthyans (skates, elephantfish, shark), agnathans (hagfish, lamprey), urochordates, or earlier. KDELR2 is the only receptor available to interact with SUMF- encoded KDEL signals in all species. The given occurrence of KDELR genes is based on species for which full-length sequences could be recovered (those indicated by an asterisk and other species, not shown). S. L. Gande et al. ER retention by noncanonical retention signals FEBS Journal 275 (2008) 1118–1130 ª 2008 The Authors Journal compilation ª 2008 FEBS 1121 effective ER retention. In conclusion, the noncanoni- cal PGEL and SGEL sequences serve as retention signals for pFGE. The data shown above reflect the levels of pFGE inside and outside the cells 24 h after induction of pFGE expression. To kinetically analyze retention and secre- tion of newly synthesized pFGE protein, doxycycline- induced cells were metabolically labeled for 90 min with [ 35 S]methionine ⁄ cysteine and analyzed by immuno- precipitation of pFGE from cell lysates and medium immediately or after 3 and 6 h of chase in unlabeled growth medium. The data obtained clearly show that truncated pFGE was significantly secreted already dur- ing pulse labeling. After 3 h of chase, only 25% of trun- cated pFGE were retained within the cells (Fig. 4B). On the contrary, very little of the wild-type and the KDEL form of pFGE was secreted during the pulse, and most of these forms were retained intracellularly after 3 h of chase (88% and 66%, respectively). The C-terminal PGEL tetrapeptide is an autonomous ER retention signal The canonical KDEL signal is known to confer ER retention to any soluble passenger protein that normally traverses this compartment on its way to the cell surface. To test whether this holds true also for the noncanonical PGEL signal, we equipped lysozyme, a typical secretory protein, with either a C-terminal KDEL or PGEL tetra- peptide. A c-Myc-tag, also located at the C-terminus, but upstream of the KDEL ⁄ PGEL extension, allowed detection through western blotting. Upon doxycycline- induced expression, 90% of lysozyme was found in the medium, whereas the form extended with KDEL was quantitatively retained inside the cells (Fig. 5). The PGEL-extended form of lysozyme was likewise effec- tively retained (76%). Using indirect immunofluorescence, we could detect lysozyme–c-Myc intracellularly in Golgi-like structures (Fig. 6B), suggesting that this compartment is the bot- tleneck for secretion of overexpressed lysozyme–c-Myc. When equipped with a C-terminal KDEL or PGEL extension, lysozyme colocalized with the ER marker protein disulfide isomerase (PDI) (Fig. 6C,D). Whereas pFGE and lysozyme–c-Myc-KDEL fully colocalized with PDI (Fig. 6A,C), a fraction of lysozyme–c-Myc- PGEL was also detected in the Golgi-like structures (Fig. 6D). This became particularly obvious under con- ditions of maximum doxycycline-induced expression, as chosen in Fig. 6. In conclusion, the noncanonical PGEL, like the KDEL tetrapeptide, is a transferable signal conferring ER retention per se. Although less efficient than KDEL, PGEL: (a) massively increases A B Fig. 4. Retention of pFGE with and without a C-terminal KDEL, PGEL or SGEL tetrapeptide. pFGE and C-terminal variants of pFGE (see text), as indicated, were transiently expressed in stable HT1080 Tet-On cells (cf. Fig. 1). (A) Six hours after transfection, the cells were induced with 2 ngÆmL )1 doxycycline. After induction for 24 h, cells and medium (at a ratio of 10 : 1) were analyzed for pFGE by western blotting. (B) Twelve hours after induction with 0.5 ngÆmL )1 doxycycline, cells were starved for 1 h and then meta- bolically labeled for 90 min with [ 35 S]methionine ⁄ cysteine. pFGE was immunoprecipitated from cell lysates and medium, harvested after 0, 3 and 6 h of chase. Equal aliquots of precipitates from cells and medium were analyzed by SDS ⁄ PAGE and phosphorimaging. Bands were quantified; intracellularly retained pFGE is given as per- centage of total. Fig. 5. The PGEL tetrapeptide confers ER retention to lysozyme. Myc-tagged lysozyme and its C-terminally extended variants (see text) were transiently expressed in stable HT1080 Tet-On cells. Six hours after transfection, the cells were induced with 1 lgÆmL )1 doxycycline. Equal aliquots of cells and medium were analyzed by western blotting, using c-Myc-specific antibodies. The intracellularly retained lysozyme is given below the lanes as percentage of total. ER retention by noncanonical retention signals S. L. Gande et al. 1122 FEBS Journal 275 (2008) 1118–1130 ª 2008 The Authors Journal compilation ª 2008 FEBS intracellular lysozyme retention (Fig. 5); and (b) clearly shifts this intracellular material from a mainly non-ER to a mainly ER localization [Fig. 6; compare lyso- zyme–c-Myc staining in (B) and (D)]. Effect of pFGE on FGE retention Formylglycine-generating enzyme and its paralog pFGE are both soluble ER-resident proteins [12,13,27]. In contrast to pFGE, FGE lacks a C-terminal reten- tion signal in vertebrates and most other species (Fig. 3; see Discussion). As there are several indica- tions that pFGE and FGE interact with each other (see Introduction), we analyzed whether pFGE confers ER retention to FGE. We constructed a Tet-On HT1080 cell line stably expressing pFGE under control of a doxycycline-responsive promoter. When the expression of pFGE was induced by addition of 6ngÆmL )1 doxycycline, secretion was very low for the first 8 h after induction (not shown). In control Tet- On HT1080 cells, expressing no pFGE, we studied the expression and secretion kinetics for FGE after transient transfection with a noninducible expression vector. FGE is secreted in two forms (37 and 42 kDa). The 42 kDa form represents the full-length FGE, whereas the major 37 kDa form results from N-terminal pro- cessing within the secretory pathway [27]. Secretion of FGE by these cells started about 12 h after transfec- tion, and was linear with time for another 10–12 h (Fig. 7A). To find out whether FGE secretion is reduced by coexpression of pFGE, FGE was transiently expressed in Tet-On HT1080 cells stably expressing pFGE (Fig. 7B). Twelve hours after trans- fection with the FGE plasmid (the starting point of A B C D Fig. 6. PGEL-mediated retention of lyso- zyme in the ER. HT1080 Tet-On cells tran- siently expressing (at 2 lgÆmL )1 doxycycline induction) pFGE (A) or lysozyme–c-Myc without (B) or with C-terminal KDEL (C) or PGEL extension (D) were analyzed by indi- rect immunofluorescence microscopy (see Experimental procedures). The merge reveals colocalization of pFGE and lyso- zyme–c-Myc with the ER marker PDI medi- ated by the C-terminal KDEL ⁄ PGEL extensions. A fraction of lysozyme–c-Myc- PGEL is detected in Golgi-like structures, as indicated by the arrows (D). S. L. Gande et al. ER retention by noncanonical retention signals FEBS Journal 275 (2008) 1118–1130 ª 2008 The Authors Journal compilation ª 2008 FEBS 1123 linear FGE secretion), pFGE expression was induced by addition of doxycycline. Measuring intracellular and extracellular FGE and pFGE every 2 h, we observed that pFGE did not interfere with FGE secre- tion (Fig. 7B,C), even though the expression of pFGE clearly exceeded that of FGE (Fig. 7B). In addition, the data shown in Fig. 7A,B may suggest that pFGE coexpression promotes N-terminal processing of FGE. However, careful quantification of many experiments (under various conditions) did not provide significant evidence for this interpretation. Discussion Human pFGE is retained in the ER through its C-terminal PGEL signal In an earlier study, we localized pFGE mainly in the ER, but found smaller amounts also in the Golgi and even in the secretions (13% of endogenous pFGE 16 h after synthesis) [23]. In this work, we found that pFGE retention is mediated by a saturable mechanism involv- ing KDEL-like signals at the C-terminus of pFGE. In fact, the canonical prototype KDEL can only be found in pFGE of four species (platypus, planorbid snail, planarian flatworm, and sea anemone; Fig. 3). Here we studied retention of human pFGE as a representative of the most common PGEL-containing pFGEs found in 21 different species. Notably, the first two positions of the PGEL do not match with any of the deposited consensus KDEL patterns (see below). We found that deletion of PGEL or positioning a tag C-terminal of PGEL more or less fully impaired retention. On the other hand, when added to the C-ter- minus of a secretory protein such as lysozyme, PGEL conferred ER retention. Thus, PGEL is an autono- mous retention signal. It conferred ER retention with similar (pFGE) or almost (76%) similar (lysozyme) efficiency as KDEL itself (Figs 4 and 5). On the one hand, this is surprising, as Pelham et al. [28] found that even the canonical HDEL, i.e. the yeast prototype retention signal with a rather conservative exchange in the first position, cannot substitute for KDEL in medi- ating lysozyme retention in COS cells. On the other hand, in vitro experiments have shown quite efficient binding of an HDEL tetrapeptide and even weak bind- ing of a DDEL tetrapeptide [29]. The latter acts as a low-efficiency retrieval signal when present at the C-terminus of lysozyme in COS cells coexpressing either the hERD2.1 or hERD2.2 KDEL receptor [30]. Here, we also studied another noncanonical variant, SGEL, as a representative of six further PGEL-like signals found in pFGE, and observed that it also con- ferred ER retention (Fig. 4A). The PGEL tetrapeptide is accessible at the surface of the pFGE molecule The PGEL C-terminus of pFGE is located on the sur- face of the molecule as part of an eight amino acid extension (AGRPPGEL) of a three-stranded b-sheet opposite to the monomer–monomer interface (Fig. 8) [25]. The last seven residues including the PGEL could not be resolved in the crystal structure, suggesting that they show a high degree of flexibility. As the directly A B C Fig. 7. Influence of pFGE coexpression on FGE retention. A Tet- On cell line stably expressing, from a doxycycline-responsive pro- moter, pFGE (B) or not (A) was transiently transfected with the noninducible FGE expression plasmid pSB-FGE at time 0. Twelve hours later, 6 ngÆmL )1 doxycycline was added to induce (B) coex- pression of pFGE at the indicated levels. Then, every 2 h, i.e. 14– 22 h after transfection, FGE expression and intracellular retention were quantified, as given below the lanes. The relative retention of FGE as observed in the absence (A) or presence (B) of pFGE is plotted in (C). ER retention by noncanonical retention signals S. L. Gande et al. 1124 FEBS Journal 275 (2008) 1118–1130 ª 2008 The Authors Journal compilation ª 2008 FEBS preceding three residues (ADA) stick out at the protein periphery (Fig. 8), the PGEL should be easily accessi- ble for binding by one of the KDEL receptors. It should be noted, however, that both PGEL and KDEL are obviously more efficiently bound when present at the C-terminus of lysozyme, as concluded from its high retention efficiency. pFGE as a retention factor for FGE? SUMF gene duplication was a rather ancient event, as in early unicellular eukaryotes such as Emiliana hux- leyi, both SUMF1 and SUMF2 genes can be found (Fig. 3). Later, SUMF2 was lost in several clades. Fig- ure 3 shows that KDEL-type signals can also be found in SUMF1-encoded FGE of several invertebrate spe- cies. In total, 11 of 69 available FGE sequences show a KDEL-type extension at the highly conserved C-ter- minal region constituting the catalytic site of FGE. Eight of those 11 species lack pFGE, because – despite generally high sequencing coverage – the SUMF2 gene is undetectable (Fig. 3). The presence of a retention signal on either FGE or pFGE lends support to the idea that in those species pFGE and FGE mutually act as retention factors, involving heterodimer forma- tion. On the other hand, pFGE ⁄ SUMF2 is systemati- cally absent from the Insecta, whereas all 18 of the insect species have FGE ⁄ SUMF1, which, however, lack a KDEL signal (Fig. 3). Thus, there are species in which a retrieval signal is provided by no, one or both SUMF-encoded proteins. Importantly, for all species expressing both FGE and pFGE, heterodimer forma- tion as a prerequisite for ER retention could apply, as pFGE always carries a KDEL-related signal. In fact, there are examples of a retention mechanism through hetero-oligomer formation with [KRH]-D-E- L-containing proteins, such as PDI ⁄ prolyl hydroxylase [31–33] and b-glucuronidase ⁄ egasyn [34]. Similarly, Ero1 retention occurs through disulfide bridge forma- tion with RDEL containing ERp44 [35]. pFGE⁄ FGE heterodimerization and ternary complex formation with sulfatases was reported by Zito et al. [24] to serve as a regulatory mechanism for FGE activity. We have to point out that, although we have several indications for binding of pFGE to sulfatases as well as to FGE, we have failed so far to biochemically prove the exis- tence of pFGE ⁄ FGE heterocomplexes. Our experimen- tal data, showing no influence of coexpressed pFGE on the secretion of FGE (Fig. 7), clearly argue against pFGE as a stand-alone retention factor for FGE. Ongoing experiments suggest that regulation of retention versus secretion of FGE employs several mechanisms, one of which involves the noncatalytic N-terminal extension of FGE. The possibility that pFGE contributes to this regulation cannot be excluded, as the FGE ⁄ pFGE coexpression experiments reported here may have missed ternary complex forma- tion with unfolded sulfatase substrates or other inter- acting components in the ER. Bioinformatic and evolutionary considerations on pFGE and KDEL signals The well-known KDEL ER retrieval signal, discovered by Munro & Pelham [36], was found to be widely used. In fact, many variants have been described, and the pattern [KRHQSA]-[DENQ]-E-L was deposited as a general consensus in the PROSITE database [26]. Informatic inspection of ER proteins deposited in the human ER Aperc¸ u (HERA) database led to the suggestion that this pattern should be extended to [KRHQSADEN]-[DENQTFIV]-E-[LF] [37]. Even more extensive bioinformatic studies compiled further variations leading to the pattern [KHRDENQAS]- [DENQIYCV]-[DENQ]-L, which shows more flexibil- ity in the penultimate position [38]. Of the C-terminal sequences of pFGE from 67 species (Fig. 3), only 17 fit with the latter consensus patterns, most of them nearly ideally (KDEL, KEDL, RDEL, RQEL, RNEL, RTEL, KTEL, HQEL). The remaining 50 sequences differ in either the first position [proline (25 sequences), methionine (one), phenylalanine (one), or threonine Fig. 8. The C-termini of the pFGE dimer are exposed at the surface of the molecule. The ribbon model of the pFGE dimer 3D structure is shown, as determined through X-ray crystallography [25]. The three N-terminal residues (27-ATS-29, in red) and C-terminal resi- dues (292-ADA-294, in yellow) of the resolved structure are shown in stick representation. Ala27 represents the N-terminus of the mature form of pFGE. The C-terminal residues 295–301 including PGEL are not visible in the crystal. The two calcium ions in each of the monomers are shown as gray spheres. S. L. Gande et al. ER retention by noncanonical retention signals FEBS Journal 275 (2008) 1118–1130 ª 2008 The Authors Journal compilation ª 2008 FEBS 1125 (one)], in the second position [glycine (28), alanine (six), proline (one), methionine (one), arginine (one), or lysine (one)], or in both positions (24). The PGEL motif accounts for 21 of the 24 sequences with non- consensus residues in both positions. In Fig. 3, the pFGE C-termini of all 67 species are ordered according to the modern taxonomic tree. It becomes obvious that pFGEs with canonical retention signals (colored in blue) originated first, and that the PGEL signal (red) developed with the mammalian line- age. PGEL can be found in many different phyloge- netic groups, from marsupials (wallaby) to primates. However, within these groups, there is fluctuation between canonical KDEL-like, PGEL and other non- canonical retrieval signals (green) in the end leaves of various subclades. We thus conclude that the invention of noncanonical retrieval signals is not coherent with specific evolutionary developments. Nevertheless, it is interesting to note that the other noncanonical signals (Fig. 3, green) found in mammalian pFGEs are rather similar to PGEL. Unfortunately, without supporting experimental data for the many pFGE species listed in Fig. 3, we cannot say whether all the variations of the retention tetrapeptide are accepted by the in-species KDEL receptor(s) and the underlying retrieval system, as this also varies over the vast phylogenetic timescale. In the mammalian system, where experimental data are avail- able, PGEL is functional as an autonomous retention signal (Fig. 5). Surprisingly, it is commonly found in mammalian pFGEs and evolutionarily conserved over a lot of branch lengths; but at the same time, it is highly specific for this protein, as becomes evident from the databases, where only very few PGEL ER proteins can be found. In fact, not a single human PGEL ER protein, apart from pFGE, and only one human protein with an N-terminal signal peptide and an SGEL C-terminus (endonuclease domain-containing protein ENDOD1), could be retrieved from Swissprot or Ensembl. The UCSC browser retrieved in addition a GDNF receptor-like protein with a PGEL C-termi- nus, which, even as a membrane protein, may be sub- jected to KDEL receptor-mediated ER retention. The specific advantage conferred to pFGE by its PGEL ter- minus needs to be determined. Relevance for KDEL receptor-mediated ER retention The topology of the KDEL receptor-binding pocket has been probed and found to involve four hydrophilic residues (Arg5, Asp50, Tyr162 and Asn165 in KDELR1) located in three different transmembrane helices, which are highly conserved and found in all three human KDEL receptor isoforms [29]. These and other data led to a model in which the KDEL peptide inserts into a charge-lined pocket formed by the trans- membrane helices [39]. Asp50 has been suggested to form an ion pair with the normally positively charged first residue of the KDEL-type signal. Such ion pairs are supposed to contribute to the very pH-sensitive association–dissociation equilibrium, with association being favored in the slightly acidic environment of the Golgi, and quantitative dissociation in the neutral ER, which has a higher pH by roughly 0.5 units [40]. This view seems to contrast with the finding reported here that even the nonpolar proline in the PGEL motif con- fers ER retention. However, in vitro peptide-binding experiments suggest that this ion pair is not obligatory, at least not for the association step, and that the sequence directly upstream of the KDEL-type tetra- peptide contributes to the interaction with the receptor [29]. Moreover, mutagenesis of Asp50 did not affect binding of DDEL-containing ligands in vitro and in vivo, which suggests that different retrieval signals make different contacts in the binding pocket. The variability in the retrieval signature could also be related to the existence of three paralogous verte- brate KDEL receptor genes. All three are found in tet- rapods (mammals, birds, reptiles, amphibians) (Fig. 3). KDELR2 is present in all eukaryotes, KDELR3 in all teleost fish and tetrapods, and KDELR1 only in tetra- pods from the frog onwards. Human KDEL receptors (ERD2) 1 and 2 are obviously ubiquitously expressed, as suggested by cDNA libraries from different tissues, but human ERD2.2 is inducible through the ER stress response [30]. Both are functionally identical with regard to lysozyme-KDEL and lysozyme-DDEL retrie- val [30]. Residues 50–56 of KDEL receptor 1 were sug- gested to determine ligand specificity [29,41]. Of these, only positions 54 ⁄ 55 show minor variations among the three KDEL receptor isoforms (50-DLFTNYI-56 ⁄ DLFTSFI ⁄ DLFTNFI). Unfortunately, no 3D model of the binding pocket is available. Coexpressing the individual receptors with pFGE might show that, indeed, a particular receptor isoform is well adapted for pFGE retrieval. Conclusions This study on the mechanism of pFGE retention in the ER has uncovered a novel retrieval signal that autonomously confers ER retention to passenger pro- teins. Surprisingly, this noncanonical PGEL variant of the classic KDEL signal, although evolutionarily con- served for most mammalian pFGEs, is not being ER retention by noncanonical retention signals S. L. Gande et al. 1126 FEBS Journal 275 (2008) 1118–1130 ª 2008 The Authors Journal compilation ª 2008 FEBS widely used by other mammalian ER proteins. Why the PGEL signal or its other noncanonical variants are specific for pFGE remains elusive at present. As long as the role of pFGE in sulfatase activation through FGE remains speculative, one can only suppose that FGE function and possibly trafficking is regulated via pFGE. If it is true that FGE trafficking out of the cell eventually reaches even the ER of other cells [42], anterograde and retrograde transport of this essential activator of sulfatases definitely need complex regula- tion. Experimental procedures Construction of expression plasmids C-terminal tetrapeptide variants of pFGE and lysozyme were constructed by cloning corresponding cDNAs into multiclon- ing site I of the pBI Tet vector (BD Biosciences, Heidelberg, Germany), which allows the simultaneous expression of two genes of interest from one bidirectional tet-responsive pro- moter. For cloning wild-type pFGE, pFGEDPGEL (‘trun- cated pFGE’) and pFGE with KDEL or SGEL instead of PGEL, pFGE cDNA [23] served as a template for an add-on PCR using 5¢-CTAGCTAGCCACCATGGCCCGGCAT GGGTTAC-3¢ as a forward primer, and reverse primers 5¢-TCTAGAGATATCTACAGCTCCCCTGGCG-3¢ (for wild-type pFGE), 5¢-TCTAGAGATATCTACGGCCGGC CTGCGTC-3¢ (pFGEDPGEL), 5¢-TCTAGAGATATCTA CAGCTCGTCTTTCGGCCGGCCTG-3¢ (pFGE-KDEL), or 5¢-TCTAGAGATATCTACAGCTCCCCGGACGGCC-3¢ (pFGE-SGEL). An NheI site was added at the 5¢-end and an EcoRV site at the 3¢-end, which facilitated directional cloning of the PCR product into multicloning site I. For cloning wild-type lysozyme–c-Myc and lysozyme– c-Myc with PGEL or KDEL at the C-terminus, plasmid pCMV2-Lys-cmyc-KDEL [43] served as a template for add-on PCR, using GTCAGCTAGCCGGCCCGCCAT GAGGTCTTTGCTAATC as a forward primer, and reverse primers 5¢-CCGGATATCGATTCACTCACTATC GATGTTGAGGTC-3¢ (for wild-type lysozyme), 5¢-CC GGATATCGATTCATAGCTCCCCTGGCTCACTATC-3¢ (lysozyme-PGEL) or 5¢-CCGGATATCGATTCATAGCTC GTCCTTCTCACT-3¢ (lysozyme-KDEL). Also here, 5¢-end NheI sites and 3¢-end EcoRV sites facilitated directional cloning of the PCR product into the pBI Tet vector. Cell culture and transfections Human HT1080 fibrosarcoma cells were grown in normal growth medium, i.e. in DMEM supplemented with 10% fetal bovine serum and 1% penicillin ⁄ streptomycin (Invitro- gen, Karlsruhe, Germany) under 5% CO 2 at 37 °C. HT1080 cells stably expressing the reverse tetracycline-controlled transactivator rtTA (Tet-On cells) and Tet-On cells stably expressing pFGE were grown in normal growth medium with neomycin or neomycin and puromycin, respectively. The stable Tet-On cell line was established by cotransfect- ing HT1080 cells with pUHrT62 (kindly provided by N. Jung, Institute of Chemistry and Biochemistry, Freie Universitaet, Germany), encoding the reverse tetracycline- controlled transactivator [44], and the neomycin-resistant vector pSB4.7pA at a ratio of 10 : 1. Transfectants were selected with increasing concentrations of neomycin from 0.2 to 0.8 mgÆmL )1 . Stable clones were screened first for doxycycline-dependent fluorescence after transient trans- fection with a pBI-EGFP plasmid. The best clones were then rescreened through western blotting for doxycycline- dependent pFGE production after transient transfection with pBI-pFGE. A Tet-On cell-line stably expressing pFGE under control of a doxycycline-responsive promoter was established by cotransfecting Tet-On cells with pBI-pFGE and the puro- mycin resistance vector pSV.pac (10 : 1 ratio). Transfec- tants were selected as mentioned above and screened for pFGE expression. Transient transfections of HT1080 Tet-On cells were per- formed using Lipofectamine 2000, following the protocol from Invitrogen. Typically, 2 lg of expression plasmid DNA (see above) was used for a 3 cm dish. After 6 h of transfection, medium was replaced by DMEM with various concentrations of doxycycline ranging between 0 and 1000 ngÆmL )1 , as indicated for each experiment (see Results and legends to Figs 1, 4, 5, 6 and 7). Cells and medium were harvested after 24 h of induction, unless otherwise specified (see figure legends), and analyzed by western blot- ting. Western blotting For western blot detection of pFGE, FGE and lysozyme– c-Myc, polyclonal antibodies to pFGE [23], FGE [27] and c-Myc (Sigma, Taufkirchen, Germany) were used as primary antibodies. Horseradish peroxidase-conjugated goat anti-(rabbit IgG1) sera were used as secondary antibodies. ECL signals were quantified using the aida 2.1 software package (Raytest, Straubenhardt, Germany). Pulse-chase experiments and immunoprecipitation HT1080 Tet-On cells, grown to 50–60% confluency, were transiently transfected with pBI-pFGE, pBI-pFGEDPGEL or pBI-pFGE-KDEL plasmids. After 6 h, the medium was replaced by medium with 0.5 lgÆmL )1 doxycycline. After 12 h of induction, cells were starved in 2 mL of methio- nine ⁄ cysteine-free DMEM for 1 h, and pulsed for 90 min with 1 mL of medium containing 100 lCi of 35 S-labeled S. L. Gande et al. ER retention by noncanonical retention signals FEBS Journal 275 (2008) 1118–1130 ª 2008 The Authors Journal compilation ª 2008 FEBS 1127 [...]... variable linker sequence (AGRP in human) and the C-terminal ER retention tetrapeptide (PGEL in human), split into the variable positions 1 and 2, and the conserved EL ⁄ DL in positions 3 and 4 Species with canonical retention signals are colored in blue, and noncanonical signals in red (PGEL only) or green (other noncanonical) Fig S2 SUMF1-encoded FGEs of some invertebrate species carry a KDEL-type ER retention. .. 1129 ER retention by noncanonical retention signals 35 36 37 38 39 40 41 42 43 44 S L Gande et al esterase and for retention within the endoplasmic reticulum J Biol Chem 270, 1191 2–1 1920 Anelli T, Alessio M, Bachi A, Bergamelli L, Bertoli G, Camerini S, Mezghrani A, Ruffato E, Simmen T & Sitia R (2003) Thiol-mediated protein retention in the endoplasmic reticulum: the role of ERp44 EMBO J 22, 501 5–5 022... (1987) A C-terminal signal prevents secretion of luminal ER proteins Cell 48, 89 9– 907 Scott M, Lu G, Hallett M & Thomas DY (2004) The Hera database and its use in the characterization of endoplasmic reticulum proteins Bioinformatics 20, 93 7– 944 Wrzeszczynski KO & Rost B (2004) Annotating proteins from endoplasmic reticulum and Golgi apparatus in eukaryotic proteomes Cell Mol Life Sci 61, 134 1–1 353 Pelham...ER retention by noncanonical retention signals S L Gande et al methionine ⁄ cysteine Cells and medium were harvested after the pulse (0 h), or after culturing in 1 mL of chase medium (DMEM with 10% fetal bovine serum, 1% penicillin ⁄ streptomycin) for 3 h and 6 h; cells were scraped off after washing with NaCl ⁄ Pi Immunoprecipitation of pFGE from cells and medium was performed... EM, Dierks T, Monti M, Cozzolino M, Pucci P et al (2007) Sulfatase modifying factor 1 trafficking through the cells: from endoplasmic reticulum to the endoplasmic reticulum EMBO J 26, 244 3–2 453 Fullekrug J, Sonnichsen B, Schafer U, Nguyen Van P, ¨ ¨ ¨ Soling HD & Mieskes G (1997) Characterization of bre¨ feldin A induced vesicular structures containing cycling proteins of the intermediate compartment ⁄... Crystal structure of an enzyme substrate complex provides insight into the interaction between human arylsulfatase A and its substrates during catalysis J Mol Biol 305, 26 9–2 77 8 Recksiek M, Selmer T, Dierks T, Schmidt B & von Figura K (1998) Sulfatases: trapping of the sulfated enzyme intermediate by substituting the active site formylglycine J Biol Chem 273, 609 6–6 103 9 Lukatela G, Krauss N, Theis K, Selmer... and mechanism for formylglycine generation of the human formylglycine-generating enzyme Cell 121, 54 1–5 52 Roeser D, Preusser-Kunze A, Schmidt B, Gasow K, Wittmann JG, Dierks T, von Figura K & Rudolph MG (2006) A general binding mechanism for all human sulfatases by the formylglycine-generating enzyme Proc Natl Acad Sci USA 103, 8 1–8 6 Hopwood JJ & Ballabio A (2001) Multiple sulfatase deficiency and the. .. Ca -formylglycine-generating enzyme J Biol Chem 280, 1490 0–1 4910 Pelham HR, Hardwick KG & Lewis MJ (1988) Sorting of soluble ER proteins in yeast EMBO J 7, 175 7–1 762 Scheel AA & Pelham HR (1998) Identification of amino acids in the binding pocket of the human KDEL receptor J Biol Chem 273, 246 7–2 472 Lewis MJ & Pelham HR (1992) Sequence of a second human KDEL receptor J Mol Biol 226, 91 3–9 16 Koivu J,... modifying factors: an ER retention by noncanonical retention signals 23 24 25 26 27 28 29 30 31 32 33 34 exclusive and promiscuous relationship Hum Mol Genet 14, 320 3–3 217 Mariappan M, Preusser-Kunze A, Balleininger M, Eiselt N, Schmidt B, Gande SL, Wenzel D, Dierks T & von Figura K (2005) Expression, localization, structural and functional characterization of pFGE, the paralog of the Ca-formylglycine... 404, 7 5–8 1 Urlinger S, Baron U, Thellmann M, Hasan MT, Bujard H & Hillen W (2000) Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity Proc Natl Acad Sci USA 97, 796 3–7 968 1130 Supplementary material The following supplementary material is available online: Fig S1 Canonical and noncanonical ER retention signals in SUMF2-encoded . Paralog of the formylglycine-generating enzyme – retention in the endoplasmic reticulum by canonical and noncanonical signals Santosh Lakshmi Gande 1 ,. indicating that the C-ter- minus of pFGE might be involved in the ER retention mechanism. pFGE carries canonical or noncanonical ER retention signals in