the writer thinks that hiding a key under a doormat or flower pot
COMBINING EVIDENCE ON AIR POLLUTION AND DAILY MORTALITY FROM THE 20 LARGEST US CITIES: A HIERARCHICAL MODELLING STRATEGY potx
... structure and prior distributions Description of the databases The analysis database included mortality, weather and air pollution data for the 20 largest metropolitan areas in the USA for the 7-year ... average, maximum and 8-h maximum, we used the 24-h mean for each day If a city has more than one weatherstation, we took the average of the measurements from all available stations The PM10 and ozone ... estimates of the parameter Recently it has been shown that the strategy based on the normal approximation of the likelihood gives an alternative two-stage model that well approximates the original...
- 40
- 526
- 0
Understanding the Insider Threat - Proceedings of a March 2004 Workshop potx
... containing examples of specific attacks, the characterization of normal behavior for users in different roles (including that of a system administrator), and artificial or real sensor data that ... Another insider installs a keystroke logger to get a few passwords to another computer in the same office • A database administrator makes an extra copy of the database files, but says the tapes ... Internal email that performs attacks MI creates and sends e-mail within the secure facility that has JavaScript or an attachment with content that installs trapdoors or creates other vulnerabilities...
- 137
- 344
- 0
Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx
... structural data supposing that the two pairs of [Fe-S] cluster both participate That recalls that two parallel electron pathways towards the a [4Fe-4S] cluster and the molybdenum cofactor with ... to undertake the catalytic reaction The location of the hemes has been studied by Rothery et al [28,29] These authors showed that the low-potential heme bL, located on the periplasmic side of the ... donors and nitrate, in each case for several ranges of time (0.5–5 s) The traces obtained are shown in Fig They are monophasic and fit a decreasing exponential equation The amplitudes obtained agree...
- 8
- 442
- 0
Integrating Gender into the World Bank’s Work: A Strategy for Action potx
... either the Bank or other agencies (governmental, international, or academic institutions) Alternatively, the Bank may rely on analytical work produced by another organization and adopt such work for ... poverty assessment or other larger analytical products (for example, a country social or economic analysis) The CGA may contain original analytical work or may refer to such work, produced by either ... gender analysis may, for example, be a stand-alone document or a section of a country poverty or economic analysis The CGA may contain original, analytical work or may simply refer to such work...
- 92
- 359
- 0
The Founder of New France: A Chronicle of Champlain pot
... either an impenetrable wilderness or an inland sea Hence Acadia remained separate from the Laurentian valley, which was the heart of Canada although Acadia and Canada combined to form New France ... him said that Vignau was a liar, and on their advice Champlain left the Ottawa a short distance above the mouth of the Madawaska Holding westward at some distance from the south shore, he advanced ... people and organizations in: Alabama, Arkansas, Connecticut, Delaware, Florida, Georgia, Idaho, Illinois, Indiana, Iowa, Kansas, Kentucky, Louisiana, Maine, Michigan, Missouri, Montana, Nebraska,...
- 49
- 353
- 0
báo cáo hóa học: " The burden of multiple sclerosis: A community health survey" pot
... 84.7% [14] Approval to access the survey data was obtained from Statistics Canada and ethical approval was obtained through the University of Alberta Health Research Ethics Board Sample In the CCHS ... important intellectual content All authors read and approved the final manuscript 18 19 20 Acknowledgements The research and analysis are based on data from Statistics Canada The opinions expressed ... responsible for the conception of the study Dr Pohar analyzed the data Dr Jones drafted the article All authors contributed to the interpretation of the results and revising the article for important...
- 7
- 395
- 0
báo cáo hóa học:" The burden of multiple sclerosis: A community health survey" potx
... 84.7% [14] Approval to access the survey data was obtained from Statistics Canada and ethical approval was obtained through the University of Alberta Health Research Ethics Board Sample In the CCHS ... important intellectual content All authors read and approved the final manuscript 18 19 20 Acknowledgements The research and analysis are based on data from Statistics Canada The opinions expressed ... responsible for the conception of the study Dr Pohar analyzed the data Dr Jones drafted the article All authors contributed to the interpretation of the results and revising the article for important...
- 7
- 215
- 0
báo cáo hóa học:" Partial vanishing viscosity limit for the 2D Boussinesq system with a slip boundary condition" potx
... Japan ∗ Corresponding author: yzhoumath@zjnu.edu.cn Email addresses: LJ: lbjin@zjnu.edu.cn GN: gnaka@math.sci.hokudai.ac.jp JF: fanjishan@njfu.com.cn Abstract This article studies the partial ... Partial vanishing viscosity limit for the 2D Boussinesq system with a slip boundary condition Liangbing Jin1, Jishan Fan2, Gen Nakamura3 and Yong Zhou∗1 Department of Mathematics, Zhejiang Normal ... read and approved the final manuscript Acknowledgments This study was partially supported by the Zhejiang Innovation Project (Grant No T200905), the ZJNSF (Grant No R6090109), and the NSFC (Grant...
- 10
- 267
- 0
báo cáo hóa học:" Partial vanishing viscosity limit for the 2D Boussinesq system with a slip boundary condition" pot
... Japan ∗ Corresponding author: yzhoumath@zjnu.edu.cn Email addresses: LJ: lbjin@zjnu.edu.cn GN: gnaka@math.sci.hokudai.ac.jp JF: fanjishan@njfu.com.cn Abstract This article studies the partial ... Partial vanishing viscosity limit for the 2D Boussinesq system with a slip boundary condition Liangbing Jin1, Jishan Fan2, Gen Nakamura3 and Yong Zhou∗1 Department of Mathematics, Zhejiang Normal ... read and approved the final manuscript Acknowledgments This study was partially supported by the Zhejiang Innovation Project (Grant No T200905), the ZJNSF (Grant No R6090109), and the NSFC (Grant...
- 10
- 166
- 0
Báo cáo y học: "Pollen allergens do not come alone: pollen associated lipid mediators (PALMS) shift the human immue systems towards a TH2-dominated respons" potx
... interests The authors declare that they have no competing interests 18 Authors' contributions All authors contributed equally to the manuscript All authors have read and approved the final manuscript ... pollen-associated lipid mediators When pollen grains are hydrated on the respiratory epithelia, they release allergens and eicosanoid lipids, the so-called pollen-associated lipid mediators (PALMs) ... CCL22 The release of CCL17, a chemokine enhanced in atopic ekzema, was not significantly changed as compared to LPS treatment alone At a functional level, Bet.-APE increased the capacity of LPS-matured...
- 6
- 378
- 0
Báo cáo y học: "The loss of health status in rheumatoid arthritis and the effect of biologic therapy: a longitudinal observational study" pot
... income, and other patient outcomes [46-49] These measures incorporate RA activity, in particular RA pain, with cumulative RA effect and damage Bansback et al indicate that that the HAQ is the ‘primary ... in RA is indistinguishable from population normative data No population normative data are available for the HAQ, but its pattern of loss is similar to that of PCS and EQ-5D These data can be ... Chartash EK: Adalimumab, a fully human anti-tumor necrosis factor alpha monoclonal antibody, for the treatment of rheumatoid arthritis in patients taking concomitant methotrexate: the ARMADA trial...
- 12
- 385
- 0
Báo cáo khoa học: "Myocardial injury in infants ventilated on the paediatric intensive care unit: a case control study" pot
... categorical data as appropriate Correction for age and weight was performed using partial correlation coefficients and by subgroup analysis We performed subgroup analysis to compare those admissions ... participated in analysis of laboratory samples and data collection and analysis References Bhayana V, Henderson AR: Biochemical markers of myocardial damage Clin Biochem 1995, 28:1-29 Hetland O, ... authors declare that they have no competing interests Authors' contributions JS Clark participated in the design of the study, performed data analysis and participated in writing the paper ME participated...
- 6
- 226
- 0
Understanding the Great Ordovician Biodiversification Event (GOBE): Influences of paleogeography, paleoclimate, or paleoecology? potx
... biogeographical identity Baltica and Laurentia, together with Avalonia, formed Laurussia during the Silurian In the Devonian, Gondwana started to collide with Laurussia, and the Carboniferous amalgamation ... Niocaill, C., and Williams, S.H., 1996, Palaeogeography of early Ordovician Iapetus terranes: Integration of faunal and palaeomagnetic data: Palaeogeography, Palaeoclimatology, Palaeoecology, v. 121, ... for correlation of the GOBE with the increased flux of meteorites and extraterrestrial chromite on Baltica, but where accurate faunal data are available, from, for example, western Russia (Rasmussen...
- 7
- 426
- 0
Tài liệu Introduction to Requirements – The Critical Details That Make or Break a Project doc
... has understood the requirements It is also important to verify that a requirements document conforms to company standards, and that it is understandable, consistent, and complete Formal notations ... of an institutions governing body to see through the organization The way to see through an organization is by documenting – creating a paper-trail – of all the transactions that occur Today, ... there are errors in requirements, they increase the need for re-work and decrease an institution’s operational efficiency This works against every institution’s goal of managing for value Therefore,...
- 9
- 506
- 0
Tài liệu Introduction to Requirements – The Critical Details That Make or Break a Project pptx
... has understood the requirements It is also important to verify that a requirements document conforms to company standards, and that it is understandable, consistent, and complete Formal notations ... of an institutions governing body to see through the organization The way to see through an organization is by documenting – creating a paper-trail – of all the transactions that occur Today, ... there are errors in requirements, they increase the need for re-work and decrease an institution’s operational efficiency This works against every institution’s goal of managing for value Therefore,...
- 9
- 417
- 0
Tài liệu Prelude To A Bull The Economic Signs That Signal Market(pdf) doc
... also started to gain despite continued weak fundamentals All of these companies have one thing in common: hope that the Fed will cut rates and thereby invigorate the expansion and boost corporate ... factors such as Uncle Sam’s buy-back of the national debt (which entails the purchase of long-dated maturities, mostly), there were clearly other reasons for the inversion that had implications ... the yield curve at the start of the year in January when it inverted for the first time in about ten years While many investors and analysts dismissed the inversion as related to technical factors...
- 3
- 317
- 0
Báo cáo khoa học: The Drosophila jumonji gene encodes a JmjC-containing nuclear protein that is required for metamorphosis pot
... were as follows: cycD-F, 5¢-GGGATCCCA CATTGTATTCG-3¢; cycD-R, 5¢-ACGGAGCTTTGAAG CCAGTA-3¢; cycE-F, 5¢-AAGGTGCAGAAGACGCA CTT-3¢; cycE-R, 5¢-AATCACCTGCCAATCCAGAC-3¢; cdk4-F, 5¢-TACAACAGCACCGTGGACAT-3¢; ... level at days after dsRNA treatment, whereas that of the 120 kDa band was unchanged throughout dsRNA treatment (Fig 2B, lane 9) Therefore, we concluded that the 120 kDa B E F D Fig Characterization ... Journal 274 (2007) 6139–6151 ª 2007 The Authors Journal compilation ª 2007 FEBS N Sasai et al catalytically inactive as histone demethylases because of the amino acid changes in the catalytic domain...
- 13
- 356
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008