the terminal tethyan event a critical review of the conflicting age determinations for the disconnection of the mediterranean from the indian ocean
Báo cáo y học: "The treatment of condylar fractures: to open or not to open? A critical review of this controversy" pdf
... Because of the relatively poor quality of the available data and the lack of other important information, the question of preferred treatment still remains unanswered, and there is clearly a need ... recent advances in prevention, diagnosis and management Int J Oral and Maxillofacial Surgery 2005; 34: 823-33 27 Banks P A pragmatic approach to the management of condylar fractures Int J Oral Maxillofac ... Journal of Oral and Maxillofacial 1997; 35: 230-6 Talwar RM, Ellis III E, Throckmorton GS Adaptations of the masticatory system after bilateral fractures of the mandibular condylar process J Oral...
- 6
- 433
- 0
Báo cáo khoa học: "Lymphatic mapping and sentinel node biopsy in gynecological cancers: a critical review of the literature" pot
... in the parametrial areas [35], whereas Levenback found 9% of the sentinel nodes in the paraaortic area, 11% in the common iliac, 71% in the external iliac, and 9% in the parametrial area in a ... blue, have caused disappointment at first [1] DeCesare et al., demonstrated the applicability of intra-operative gamma ray use, and a year later, Hullu et al., demonstrated the applicability of a ... Although majority of the nodes are located in internal iliac and external iliac areas, nodes have been found in also presacral, parametrial and pararectal areas [33] In a sentinel node study carried...
- 12
- 511
- 0
Báo cáo y học: "A critical review of the research literature on Six Sigma, Lean and StuderGroup''''s Hardwiring Excellence in the United States: the need to demonstrate and communicate the effectiveness of transformation strategies in healthcare" pdf
... phrases organizational transformation and transformational changes For example, King defined organizational transformation as, 'a planned change designed to significantly improve overall organizational ... developed from the transformation are retained and transferred to other problems and parts of the healthcare organization The two exceptions to the question of sustainability are Furman and Caplan's ... Management in the School of Rural Public Health at the Texas A& M Health Science Center in College Station, Texas Additional material Additional file Table S1 Summaries of organizational transformation...
- 9
- 821
- 0
báo cáo khoa học: " A critical review of the research literature on Six Sigma, Lean and StuderGroup''''s Hardwiring Excellence in the United States: the need to demonstrate and communicate the effectiveness of transformation strategies in healthcare" pot
... phrases organizational transformation and transformational changes For example, King defined organizational transformation as, 'a planned change designed to significantly improve overall organizational ... developed from the transformation are retained and transferred to other problems and parts of the healthcare organization The two exceptions to the question of sustainability are Furman and Caplan's ... Management in the School of Rural Public Health at the Texas A& M Health Science Center in College Station, Texas Additional material Additional file Table S1 Summaries of organizational transformation...
- 9
- 644
- 0
báo cáo khoa học: " Can one puff really make an adolescent addicted to nicotine? A critical review of the literature" potx
... they are generally downplayed and not affect the decisiveness of the conclusions Interpretation of the findings is often biased and obvious caveats and alternative explanations for the data are ... asked them, among other aspects of their experience, about addiction and loss of autonomy The claim that participants could validly report physical addiction to nicotine was based on the observation ... that “When asked what exactly it was they were addicted to, participants readily answered that it is the nicotine in cigarettes.” Clearly, the responders had no way of knowing this for a fact and...
- 9
- 387
- 0
university of california press a critical history of early rome from prehistory to the first punic war feb 2005
... to arrive at many firm conclusions about the overall character of these languages and their historical links to one another.1 Before Latin began to drive the other languages of ancient Italy ... Etruria The other major Sabellian dialect was Oscan, which was the speech of the Samnites, the non-Greek inhabitants of Campania, and the people of Lucania and Bruttium The people living in the ... territorial boundaries and having an urban center that served as the major political and social focal point of the state The local kings of the Greek dark age gave way to aristocratic oligarchies,...
- 421
- 379
- 0
Báo cáo khoa học: "A critical review of larch hybridization and its incidence on breeding strategies" potx
... resistance (e.g., larch canker) are the main selection criteria Wide soil adaptability and growth uniformity are also of importance A great deal of genetic variability exists for these traits in larch ... rates comparable to other vigorous species such as Douglas fir and an apparent wide soil adaptability on Rational use of the parental populations and their evaluation through hybridization as ... mercial utilization through mass propexploitation in F generation agation by either sexual or vegetative Parental species populations are methods To take maximum advantage of maintained separately...
- 13
- 423
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... be other meiotic clade AAA ATPases and have the AAA domain helix and the C -terminal helix, but not the b domain The distinguishing feature of members of the meiotic clade of AAA ATPases is the ... research efforts are currently aimed at achieving a detailed understanding of the roles of the numerous components of the MVB sorting machinery Vps4 is an ATPase of the AAA (ATPase associated...
- 23
- 490
- 0
The economic benefits of publicly funded basic research: a critical review doc
... of academic research have a major advantage over those located at a distance:13 11 Acs et al used a database of innovations prepared by the US Small Business Administration in 1982 The database ... differences across industries in the relationship between academic research and industrial innovation Table is based on a statistical analysis of the Pace survey of European industrial managers ŽArundel ... Moreover, the approach yields only the average rate of return, not the marginal rate, so it cannot inform policy makers about the marginal benefits of additional research funding ŽOTA, 1986, p 4; David...
- 24
- 386
- 0
Báo cáo y học: "Standards of evidence in chronobiology: critical review of a report that restoration of Bmal1 expression in the dorsomedial hypothalamus is sufficient to restore circadian food anticipatory rhythms in Bmal1-/- mice" pot
... Shin Yamazaki, Wataru Nakamura and Takahiro Moriya for sharing unpublished data, and many colleagues and three anonymous reviewers for comments and support References Schwartz WJ: Suprachiasmatic ... Bmal1-/- mice have physical limitations that may impair their ability to reach food available in standard cage top food hoppers Food was therefore placed on the floor for additional baseline days ... eat for an hour or so and then take a post-prandial pause before eating again Errors of these types are not mutually exclusive (e.g., some waveforms appear misaligned, and others exhibit characteristics...
- 13
- 349
- 0
báo cáo khoa học:" Measuring the psychosocial health of adolescent and young adult (AYA) cancer survivors: a critical review" doc
... measures for assessing psychosocial outcomes in AYA cancer survivors These databases were chosen as they all provide extensive coverage of journals in the field of cancer research The database search ... reported for any of the measures Cross-cultural adaptation Two measures, the MMQL Adolescent Form and PedsQL 3.0 Cancer Module (C &A) , have been adapted for cultures other than the United States For the ... language and covered the last ten years from 1998 to 2008 This timeframe was selected as a preliminary search of Medline for all AYA related psychosocial research without a year limitation revealed...
- 13
- 245
- 0
Báo cáo y học: "Systematic review: Intra-aortic balloon counterpulsation pump therapy: a critical appraisal of the evidence for patients with acute myocardial infarction" doc
... [10], randomization took place at the end of the initial emergency catheterization, before the patient was transferred to the critical care unit (CCU) The randomization was stratified by clinical ... later assigned to standard care Intracoronary thrombolysis was used in 42% of patients later randomized to IABP therapy compared to 46% of patients in the standard therapy arm Intravenous heparin ... a single measure of its desirability from an efficiency perspective Critical appraisal of the economic analysis of IABP therapy in AMI patients The factors which we consider when critically appraising...
- 6
- 575
- 0
Environmental performance and sustainable architecture a critical review in the context of singapore public housing 2
... (1991) and Harker (1989) The matrix of pair-wise comparisons A = (aij) can be established as follows: A1 A2 An A1 a1 /a1 a1 /a2 a1 /an A2 a2 /a1 a2 /a2 a2 /an An an /a1 an /a2 an/an 149 ... (aij), and (2) to establish weights of a set of criteria (w1, w2, , wn) from that matrix The following is a brief summary of the mathematical theory of the AHP, as reference to Saaty and Vargas ... outward appearance of the buildings, safety of occupants of other flats, safety of the buildings, or for the preservation of the peaceable enjoyment by the other occupants of their own flats and...
- 75
- 365
- 0
Environmental performance and sustainable architecture a critical review in the context of singapore public housing 3
... of available point that horizontal and downward views are available of the interior of bedroom and living areas of certain percentage of dwelling units of the building Interpreting from the above ... (Af) and the percentage of hard-paved area of the site (P) should be kept as low as possible, and the total net usable area of the building (Anet) should be as large as possible In Singapore, scarcity ... being the third lowest among the scores of all case studies This is due to the large surface parking area, resulting in small percentage of greenery area in the total site area, and the rather large...
- 131
- 400
- 0
Environmental performance and sustainable architecture a critical review in the context of singapore public housing 4
... potential sustainable performance of the project, based on the information available at the end of the Design phase Because the information available during the Pre-Design and Design phases are likely ... potential sustainable performance of the project, based on the information available at the end of the Pre-Design phase." The Design phase assessment is intended to indicate the future potential ... practice into their established ways of designing (Hagan, 2003) The Integrated Framework encourages and facilitates architectural students to engage in a truly interdisciplinary approach as early...
- 59
- 395
- 0
Environmental performance and sustainable architecture a critical review in the context of singapore public housing 1
... places, they had easy access to plant food and water Small animals that came to drink and feed there were easy prey The humans had only to protect themselves from attack from predatory animals ... data for further discussions in Part III Part III compiles a set of empirical analyses and discussion in order to substantiate the theoretically critical review of the practice of BEAMs and the ... discourse (Hagan, 2001) As a result of the analysis above and the contestation between the three domains, the approaches towards sustainable built environment from the three domains are often fragmented,...
- 113
- 271
- 0
Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc
... higher rates than usual radical rearrangements [98,312] On the other hand, the timing of radical rearrangement (radical clocks) may depend critically on the tightness of the radical cage and the ... Corina, D & Akhtar, M (1996) The mechanism of the acyl-carbon bond cleavage reaction catalyzed by recombinant sterol 1 4a- demethylase of Candida albicans (other names are: lanosterol 1 4a- demethylase, ... [68], the enzyme variant still mediated N-oxygenation of the tertiary arylamine at a rate less than half that of the wild-type-catalyzed reaction [142], so that reasonable interpretation of the data...
- 26
- 746
- 0
Mental health aspects of women’s reproductive health: A global review of the literature pdf
... on the mental health aspects of reproductive health 167 Photo credits Cover page page 17 page 23 page 25 page 52 page 58 page 69 page 91 page 114 page 117 page 118 page 129 page 135 page 148 page ... Mlay Akwillina, Reproductive Health Project, Tanzania; Mary Jane Alexander, Nathan Kline Institute for Psychiatric Research, USA; Faiza Anwar, Women’s Health Educator, Australia; Victor Aparicio ... initiated to gather state of the art information on reproductive and mental health issues from a variety of researchers and interested parties Valuable data from consultant reports, national programme...
- 181
- 484
- 0
Nitrosamine and related food intake and gastric and oesophageal cancer risk: A systematic review of the epidemiological evidence ppt
... may be related to salt and NOC, in enhancing carcinogenesis after the epithelium is damaged[8] The aim of this article is to review and evaluate the available epidemiological evidence about the ... M, Natsukawa S, Shaura K, Koizumi Y, Kasuga Y, Hanaoka T, Tsugane S Association of Helicobacter pylori infection and environmental factors in non-cardia gastric cancer in Japan Gastric Cancer ... validated methodologies that allow an accurate assessment of production are needed Therefore, measurement and quantification of DNA adducts of nitrosamines in humans may be the most direct way...
- 8
- 555
- 0
Chart of Accounts: A Critical Element of the Public Financial Management Framework potx
... around the financial transactions the managers of government agencies can enter into; and (ii) the reporting arrangements for evaluating the performance of managers (of government agencies) and the ... INTERNATIONAL MONETARY FUND Fiscal Affairs Department Chart of Accounts: A Critical Element of the Public Financial Management Framework Prepared by Julie Cooper and Sailendra Pattanayak Authorized ... d M A N U A L s Chart of Accounts: A Critical Element of the Public Financial Management Framework Prepared by Julie Cooper and Sailendra Pattanayak This technical note and manual (TNM) addresses...
- 27
- 654
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008