0

the structure of human interferon β 1a avonex® and its relation to activity a case study of the use of structural data in the arena of protein pharmaceuticals

Báo cáo khoa học:

Báo cáo khoa học: "Computational structure of generative phonology and its relation to language comprehension." pdf

Báo cáo khoa học

... reaxrange the boundaries given by the syntax when the intonational phrasing of an utterance does not correspond to its syntactic phrasing (so-called "bracketing paradoxes") In this case, boundaries ... when the ATM computation halts and accepts If, on the other hand, the surface form contains any nonhalting or nonaccepting units, then the ATM does not accept its input w in polynomial time The ... a rule R,~_, at the end of the cycle that adds an extra boundary symbol to each end of the derivation string, unless the simulated machine has halted The remaining details are omitted, but may...
  • 8
  • 429
  • 0
Báo cáo y học:

Báo cáo y học: "The organisation of the stress response, and its relevance to chiropractors: a commentary" pdf

Báo cáo khoa học

... such variables in the diagnosis and management of pain should endeavour to measure variables of the stress response to support rhetoric that their management approaches can manage chronic pain and ... explain some of the clinical observations being made and recorded in the journals A review by Siegrist and Marmot discusses psychosocial variables as causative, aggravating, and perpetuating factors ... T, Krukoff TL, Jhamandas JH: Branching projections of catecholaminergic brainstem neurons to the paraventricular hypothalamic nucleus and the central nucleus of the amygdala in the rat Brain Res...
  • 13
  • 382
  • 0
Báo cáo y học:

Báo cáo y học: "A catalog of human cDNA expression clones and its application to structural genomics" pps

Báo cáo khoa học

... including search functionality was developed, using the Java programming language Determination of reading frames The reading frame of a cDNA insert was determined using the following formula: ... resistance to 15 µg/ml kanamycin and carries the lacIQ repressor and the argU gene for the arginine tRNA that recognizes the rare codons AGG and AGA The low abundance of this tRNA is especially ... ORF start position in Ensembl depends on experimental data from other databases and is not determined automatically Many transcript sequences in the Ensembl database were generated automatically...
  • 8
  • 274
  • 0
Báo cáo toán học:

Báo cáo toán học: "A density result for random sparse oriented graphs and its relation to a conjecture of Woodall" pptx

Báo cáo khoa học

... conjectured that, for any oriented graph G, a minimum oriented cut in G has cardinality equal to the maximum cardinality of a family of pairwise disjoint transversals of oriented cuts Woodall’s conjecture ... more than one third of its arcs Hence, the oriented girth of T is larger than the maximum cardinality of a family of pairwise disjoint transversals and, therefore, T is a counterexample to this ... cycles of G A dual version of Woodall’s conjecture may be stated as follows: for any planar oriented graph G, the oriented girth of G is equal to the maximum cardinality of a family of pairwise...
  • 10
  • 278
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Strength properties of thermally modified softwoods and its relation to polymeric structural wood constituents" pot

Báo cáo khoa học

... perpendicular to the grain (radial and tangential) is much lower than parallel to the grain (longitudinal) The presence of different types of bonds, strong and stiff bonds along the chain axis and weak and ... required to cause static failure [55] According to Winandy and Rowell [55] repeated or fatiguetype stresses usually result in a slow thermal build-up within the material and initiate and propagate tiny ... level); and fiber -to- fiber bonding with the middle lamella acting as the adhesive (macroscopic level) According to Sweet and Winandy [45] wood fibres can be regarded as a composite material and a single...
  • 12
  • 365
  • 0
Báo cáo y học:

Báo cáo y học: ": Gastrointestinal relapse of multiple myeloma and sustained response to lenalidomide: a case repo" pps

Báo cáo khoa học

... involved the gastrointestinal tract [1,2] Only one out of six extramedullary relapses reported by a North American Institution involved the gastrointestinal tract [3] All of these cases had a poor ... with a maximal survival rate of 106 days from diagnosis Finally, Dawson et al reported the case of a 60-year-old patient with MM with hematemesis, melena and gastroduodenal mucosal lesions [4] The ... the management of the patient PRB wrote the manuscript with support from TAM and PYD TAM and XM reviewed and interpreted the pathology slides and CT scan images, respectively All authors read and...
  • 3
  • 349
  • 0
TEACHERS’ BELIEFS AND PRACTICES ABOUT ESP TEACHING a CASE STUDY AT HANOI UNIVERSITY OF INDUSTRY

TEACHERS’ BELIEFS AND PRACTICES ABOUT ESP TEACHING a CASE STUDY AT HANOI UNIVERSITY OF INDUSTRY

Tổng hợp

... 1997:192) A case study consists of three stages which are data input (data presented through texts, audio and video recordings), data processing (understanding and manipulating data) and output ... any inconsistence between teachers’ beliefs and practices Finally, the data was gathered and analyzed to disclose the main findings and answer the research questions 1.6 Significance of the study ... researcher used to conduct the study The next chapter will focus on data analysis and findings 22 CHAPTER THREE: DATA ANALYSIS AND FINDINGS 3.1 Interview The transcript data collected in four interviews...
  • 69
  • 905
  • 0
Tài liệu Báo cáo

Tài liệu Báo cáo " Climate change adaptation from small and medium scale hydropower plants: A case study for Lao Cai province " doc

Báo cáo khoa học

... Atmospheric-Ocean Global Circulation Models, are used to assess climate change impacts in Lao Cai Province, namely: Baseline scenario using the historical data and simulating the climate during ... from the investor and the provincial and local authorities must be ensured; (4) Adherence to the policy relating to land clearance approved by the government and the People’s Committee of Lao Cai ... (targeted and others), and to assess the overall result anticipated by each of the main transmission channels which are: prices, employment, transfers, access, authority and assets Important aspects of...
  • 9
  • 546
  • 0
Women’s Employment and Its Relation to Children’s Health and Schooling in Developing Countries: Conceptual Links, Empirical Evidence, and Policies pptx

Women’s Employment and Its Relation to Children’s Health and Schooling in Developing Countries: Conceptual Links, Empirical Evidence, and Policies pptx

Sức khỏe trẻ em

... breastfed and the duration of breastfeeding, preventative and curative medical care, and the quantity and quality of time of the mother or others in care-related activities The quality of child care ... basic human and labor rights; in the standard taxonomy the former would instead be classified as ‘cash standards’.47 Above it was noted that financing childcare and other family services out of tax ... cognitive ability and schooling attainment, they calculate benefit to cost ratios in the range of 2.4 to 3.1, depending on the assumptions used about impacts As Van der Gaag and Tan note, these ratios...
  • 52
  • 465
  • 0
Food Label Use and Its Relation to Dietary Intake among US Adults

Food Label Use and Its Relation to Dietary Intake among US Adults

Thạc sĩ - Cao học

... values for total energy, total fat, saturated fat, cholesterol, and sugars; and users of the health claims had lower reported values for total fat and saturated fat Reported dietary fiber intake ... Covariates onlyc Use of Nutrition Facts panelc Use of list of ingredientsc Use of serving sizec Use of health claimsc Use of total fat informationde Saturated fat intake (g/d) Covariates onlyc Use ... ***PϽ0.001 for total energy, total fat, saturated fat, and sugars; users of the list of ingredients had lower reported values for total fat, saturated fat, and sodium; users of the serving size had lower...
  • 5
  • 266
  • 0
Báo cáo y học:

Báo cáo y học: " Early atherosclerosis in systemic sclerosis and its relation to disease or traditional risk factors" pdf

Báo cáo khoa học

... macrovascular disease and the severity of SSc This might explain the absence of increased levels of endothelial activation markers All these data point to the absence of premature atherosclerosis in ... immunosuppressive agents Markers of inflammation, such as CRP, are related to the risk of cardiovascular and peripheral vascular disease Increased levels of CRP are associated with increased risk of symptomatic ... been performed in the last decade using IMT of the carotid artery as a marker of early atherosclerosis Lekakis and colleagues [22], Kaloudi and colleagues [23], and Bartoli and colleagues [24,25]...
  • 8
  • 399
  • 0
Báo cáo y học:

Báo cáo y học: "Gastroesophageal reflux in mechanically ventilated pediatric patients and its relation to ventilator-associated pneumonia" ppt

Báo cáo khoa học

... non-survivors indicating a strong relation between acidic reflux and high mortality rate in VAP patients Acid and pepsin are the major factors responsible for symptoms and esophageal mucosal damage in gastroesophageal ... duration of PICU stay, setting of mechanical ventilation, history of medications, type of nutrition and the fate of all patients Full clinical examination and estimation of the angle of back ... with the total mortality in 2007 being 30% The overall rate of mechanical ventilation in the same year was 70% with half of these patients developing VAP The mortality among the VAP patients was...
  • 5
  • 312
  • 0
Effects of appropriate pre-listening activities on 10th form students' English listening comprehension a case study at Buon Ma Thuot High school in Dac Lac  Hiệ

Effects of appropriate pre-listening activities on 10th form students' English listening comprehension a case study at Buon Ma Thuot High school in Dac Lac Hiệ

Sư phạm

... listening skills Including talking to learners in the target language, raising learners' awareness of their listening styles and strategies and introducing a range of materials, speaking styles and ... listening as a process of receiving what the speaker actually says, constructing and representing meaning, negotiating meaning with the speaker and responding, and creating meaning through involvement, ... give a clear lead in what they are going to hear; use some kinds of visual back up for them to understand; give questions and tasks in order to clarify the things in their minds; and be sure that...
  • 55
  • 872
  • 0
URBAN TEXTURE ANALYSIS AND ITS RELATION TO BUILDING ENERGY CONSUMPTION

URBAN TEXTURE ANALYSIS AND ITS RELATION TO BUILDING ENERGY CONSUMPTION

Kỹ thuật - Công nghệ

... Exposure Factor average of daily solar radiation average of solar radiation maximum of the day average of daily solar radiation total Storey height Staggering of Blocks Arrangement Screening Tool ... plot ratio and gross floor area In the face of rapid urbanization, the relationship between building density and urban form has attracted wide interest Martin and March analyze the relationship ... far the urban texture and micro-climatic condition are affecting each other, and the possibility to transform this relationship into a practical analysis approach for urban performance evaluation...
  • 344
  • 246
  • 0
báo cáo sinh học:

báo cáo sinh học:" The double burden of human resource and HIV crises: a case study of Malawi" docx

Điện - Điện tử

... years of training and provide a range of medical services, including diagnosis and treatment, surgery and anaesthesia, and mending fractures They form the cornerstone of hospital care in many ... EHRP to increasing the availability of staff for the expanding ART programme both in total and in underserved areas This is consistent with the growing acknowledgement that the basic human infrastructure ... getting contracts and payment due to administrative delays One problem was that the promised 52% salary top-up was not translated into a 52% increase in take-home pay because of changes to the tax...
  • 13
  • 585
  • 0
Báo cáo y học:

Báo cáo y học: "β A randomized, controlled trial of interferon-β-1a (Avonex®) in patients with rheumatoid arthritis: a pilot study [ISRCTN03626626]" pptx

Báo cáo khoa học

... arms of a trial of interferon- β- 1a in patients with rheumatoid arthritisa Response, according to ACR criteria, of subjects in a trial of β interferon- β- 1a in patients with rheumatoid arthritis Adverse ... http://arthritis-research.com/content/6/1/R73 Table β Baseline characteristics of subjects in placebo and active-drug arms of a trial of interferon- β- 1a in patients with rheumatoid arthritis Characteristic Mean age ... terminating the study before week 24, only two in the IFN -β- 1a arm and one in the placebo arm left the study secondary to adverse events The majority of patients Available online http://arthritis-research.com/content/6/1/R73...
  • 5
  • 365
  • 0
Organizing pairwork and groupwork in the context of high school classrooms at pham van nghi upper secondary school, nam dinh province: A case study

Organizing pairwork and groupwork in the context of high school classrooms at pham van nghi upper secondary school, nam dinh province: A case study

Thạc sĩ - Cao học

... related to the study : Communicative approach to language teaching, and pairwork and groupwork in language teaching and learning 1.1 Communicative approach to language teaching 1.1.1 What is meant ... Hanoi teachers’ training University In the past, most of these teachers mainly used the GrammarTranslation Method - a way of teaching and learning a foreign language on the basis of detailed analysis ... working in pair and group According to Adrian Doff, students can practise language together, study a text, research language or take part in information- gap activities in pairwork They also can...
  • 62
  • 1,350
  • 6
Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh

Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh

Môi trường

... latrines and hand pumps which were installed at the beginning of the establishment of Bauniabad area The main activities included; (i) a baseline and needs assessment survey, (ii) training of ... sources and practices about drinking water, types of latrines, cost and financial aspects, local community participation, hygiene practices, and other water and sanitation issues Participatory data ... biogas plant to the Plan International, because people came to know the benefit of having the connection of their latrines to biogas plants At the installation, the community agreed to share the...
  • 9
  • 971
  • 0
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

Môi trường

... (5'!3') AGAGTTTGATCCTGGCTCAG GGCTACCTTGTTACGACTT CTGGAGTTTGGCAGAGGG GTTAGCTACGGCACTAAAAGG CCGTCATCTACWCAGGGTATTAAC CCCTCTGCCAAACTCCAG GTTAGCTACGGCACTAAAAGG GCTGCCTCCCGTAGGAGT GCAGCCACCCGTAGGTGT ... Quantification using Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the laboratory-scale and the full-scale activated sludge were quantified ... DNA extracted from activated sludge were evaluated In addition, the amount of Candidatus ‘Accumulibacter phosphatis’ in laboratory-scale EBPR and full-scale activated sludge samples were quantified...
  • 7
  • 719
  • 0
Potential biogas production from sewage sludge: A case study of the sewage treatment plant at Kwame Nkrumah university of science and technology, Ghana

Potential biogas production from sewage sludge: A case study of the sewage treatment plant at Kwame Nkrumah university of science and technology, Ghana

Sinh học

... university campus feed the main pumping station at the entrance of the treatment plant At the main pumping station, solid materials such as papers, glass, etc are removed by a screen The sewage is then ... collected and analysed to determine the quality of the sewage The main component of interest was the Total Volatile Solids (TVS) present in sewage which would establish the component of the sewage that ... objective of the study is to determine the biogas potential of the sewage at the Primary Sedimentation Tank (PST) at the KNUST sewage treatment plant and its potential power production Feedstock analysis...
  • 8
  • 879
  • 1

Xem thêm