the role of sp c for the structure function relationship of ps
Báo cáo khóa học: The structure–function relationship in the clostripain family of peptidases potx
... Biochem 271) ể FEBS 2004 Fig Determinants of P1 substrate specicity in (A) clostripain (specic for Arg) (B) caspase (specic for Asp) and (C) gingipain (specic for Arg) The same colouring by secondary ... the residue preceding the catalytic Cys The conservation of this interaction is suggestive of its Fig The nal model of the clostripain catalytic domain The ribbon is coloured according to secondary ... matching of caspase secondary structure with clostripain predicted secondary structure (Fig 3) At certain key points, residue conservation could be used to improve condence in the correctness of...
- 10
- 433
- 0
Báo cáo y học: "What does the structure-function relationship of the HIV-1 Tat protein teach us about developing an AIDS vaccine?" ppsx
... conformational changes [43] Theses mutations between the vaccine and the virus used for the challenge might explain the lack of efficacy of the Tat vectored vaccine in the second study [105] The second ... almost certainly related to the capacity of Tat to cross cell membranes Peptides corresponding to the different Tat regions show the same capacity of change in the secondary structures with respect ... β-turn structure independently from the other regions [43] Chemical modification of the seven cysteines dramatically changes the CD spectrum of Tat Bru (Figure 2) revealing significant structural changes...
- 13
- 647
- 0
Báo cáo toán học: "Short term interactions between tree foliage and the aerial environment: An overview of modelling approaches available for tree structure-function model" potx
... mechanistic model In some cases, the ratio of the partial pressure of CO2 in the intercellular air spaces to the partial pressure of CO2 at the leaf surface Ci/Cs is computed by an empirical function ... member accounts for interception according to the projected area of the vegetation components G in direction and zenith angle The second term of the right member accounts for scattering: it increases ... assuming a constant light use efficiency transpired for the shade leaves at the centre of the tree crown, up to 4.5 gC kgH2O1 water transpired for the sun leaves at the edge of the crown Because of this...
- 20
- 480
- 0
Tài liệu Báo cáo khoa học: Second messenger function and the structure–activity relationship of cyclic adenosine diphosphoribose (cADPR) doc
... modification of the northern ribose, cyclic ADP carbocyclic ribose (cADPcR; Fig 3), showed weaker Ca2+ release activity indicating that the oxygen atom of the northern ribose is indeed important for Ca2+ ... situation is unique for the northern ribose since replacement of the oxygen by a carbocyclic bridge in the southern ribose in the molecule termed cyclic aristeromycin diphosphoribose (cArisDPR, Fig ... N1-cIDPR, a cyclic molecule in which the cyclic bond is made between the anomeric C1 of the northern ribose and N1 of inosine (Fig 4), while N7-cIDPR showed no Ca2+ release activity in sea urchin egg...
- 8
- 469
- 0
Báo cáo y học: "Towards a better understanding of the role of psychological variables in arthritis outcome research" potx
... rheumatologist, for critically reading the manuscript and Dr Wojciechowski, clinical psychologist, for the interesting discussion Competing interests The author declares that they have no competing ... allocation of resources This contradicts with the paradigm in health economics that ‘objective’ societal preferences should be used, with the aim of avoiding the influence of ‘subjective’ mechanisms ... range of psychological variables, each representing a different construct, were analyzed in one study Each construct considered was shown to be independently important Remarkably, those psychological...
- 3
- 256
- 0
Báo cáo khoa học: Alternative splicing: role of pseudoexons in human disease and potential therapeutic strategies pot
... exon, the formation of a stop codon causes activation of the NMD pathway On the other hand, when inclusion of this pseudoexon occurs with the upstream smooth muscle tissue-speci c exon, then it can ... to modulate the splicing pattern by steric hindrance of the recruitment of the splicing factors to the targeted splicing competent cis-elements, thus forcing the machinery to use the natural ... aberrant splice sites for long-term restoration of correct splicing Targeting aberrant splice sites activated due to mutations AONs block access of the splicing machinery to the pseudoexonic regions...
- 15
- 467
- 0
Báo cáo khoa học: Structure–function relationship of novel X4 HIV-1 entry inhibitors – L- and D-arginine peptide-aminoglycoside conjugates pptx
... stereo-specificity of the interaction of the APACs with CXCR4 This is further manifested by the 50% therapeutic index (TI50), which is the 50% cytotoxic concentration (CC50) ⁄ EC50 ratio, of the compounds For ... spectrometry The second step of the synthesis involved full protection of the remaining amino groups with Cbz, achieved by the reaction of benzylchloroformate (CbzCl) in the presence of sodium carbonate ... are conjugates to neomycin) interact with CXCR4 (the main cellular coreceptor for T-tropic HIV-1 isolates), but not with CCR5 [20,22,23] Thus, the capacity of the various APACs to block the binding...
- 14
- 433
- 0
Comparatives study on sequence structure function relationship of human short chain dehydrogenases reductases
... structure of each of the five consensus sequences was also conducted We identified a representative structure for each of the five groups recovered in the phylogenetic reconstructions using the ... biological accuracy, execution time and memory usage The most accurate programs according to benchmark [16,17] tests are MUSCLE and T-COFFEE In practice, accuracy claims can be difficult to validate ... matrix (Fitch, 1990) is based on the minimum number of nucleic acid/amino acid which must be changed in order to convert the codon for amino acid to the codon of another amino acid The most common...
- 53
- 377
- 0
Báo cáo khoa học: Essential role of the C-terminus in Melanocarpus albomyces laccase for enzyme production, catalytic properties and structure pdf
... 5¢-ACCCCAAGATCGACTGGGCGG TAAG CGTCGCGCTGGGTGGAGGA-3¢ and 5¢-TCCTCCACC CAGCGGCGACGCTTACCGCCCGAGTCGATCTTGG GGT-3¢ were used as forward and reverse primers, respectively For construction of the Tr(delDSGL559) ... mutant, the forward primer 5¢-CGAATCCCTACCCCAAGATCTGAT CGGGCCTGAAGCGTCGCCG-3¢ and the reverse primer 5¢-CGGCGACGCTTCAGGCCCGATCAGATCTTGGGG TAGGGATTCG-3¢ were used Briefly, the mutagenesis was achieved ... AAGCGCCCGAGTCGATCTTGG-3¢ For construction of the Sc(delDSGL559) mutant, the primers used were as follows: forward, 5¢-ACCCCAAGATCTAATCGGGCCTG TAGC-3¢; and reverse, 5¢-GCTACAGGCCCGATTAGAT CTTGGGGT-3¢...
- 16
- 452
- 0
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
... the use of BCG vaccine for the control of TB (2 ) Based on available information concerning the effectiveness of BCG vaccine for preventing serious forms of TB in children, this statement recommended ... Recommendations) The following sections discuss BCG vaccines, the protective efficacy and side effects associated with BCG vaccination, considerations and recommendations for the use of BCG vaccine ... sufficiently substantial to preclude analysis of the data for the use of BCG vaccine in HCWs In summary, the recently conducted meta-analyses of BCG protective efficacy have confirmed that the vaccine...
- 27
- 1,309
- 3
Tài liệu The Role of Nutrition in Maintaining Health in the Nation’s Elderly: Evaluating Coverage of Nutrition Services for the Medicare Population ppt
... efficacy of the role of nutrition in diseases or conditions is independent of particular settings of care Each of the conditionspecific chapters addresses the strength of the evidence for the ... by the Academy, the Council has become the principal operating agency of both the National Academy of Sciences and the National Academy of Engineering in providing services to the government, the ... research, dedicated to the furtherance of science and technology and to their use for the general welfare Upon the authority of the charter granted to it by the Congress in 1863, the Academy...
- 383
- 606
- 2
Tài liệu Báo cáo Y học: Role of sulfoquinovosyl diacylglycerol for the maintenance of photosystem II in Chlamydomonas reinhardtii ppt
... decrease of PSII activity in hf-2 by the lack of speci c binding of SQDG to the PSII complex Alternatively, the change of the lipophilic surrounding at QB site of the PSII complex might cause the decrease ... of the antenna size in PSII, or a decrease in the efficiency of energy transfer from LHCII to the reaction center [17] Therefore, a conformational change of the PSII complex may cause the decrease ... [19] The decrease of PSII activity in hf-2 compared with that of the wild-type is therefore neither due to the change in peptide composition of the PSII complex nor to the ultrastructure of thylakoid...
- 6
- 500
- 0
Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc
... Enzyme Recombinant core tyrosinase To further asses the functional importance of the C- terminal extension, we created a shortened form of the V spinosum tyrosinase, using the presence of the conserved ... been hypothesized to be a result of the presence of an amino acid that occludes the active site This idea has been proposed because of similarities in the structures of the C- terminals of the related ... medical aspects Acta Biochim Pol 53, 429–443 21 Steenbergen JN & Casadevall A (2003) The origin and maintenance of virulence for the human pathogenic fungus Cryptococcus neoformans Microbes Infect...
- 13
- 778
- 0
Role of The Controller - Mike Allred Associate Vice Chancellor for Finance & Controller UC-Davis doc
... Global Crossing, WorldCom, HealthSouth… – Created a new accounting oversight board to police the practices of the accounting profession – Strengthened auditor independence rules – Increased the accountability ... of honesty, accuracy, and objectivity They are also expected to demonstrate accountability for sponsors’ funds and to comply with specific terms and conditions of contracts and grants Research ... dignity of others UC Standards of Ethical Conduct Fair Dealing • …No unlawful practice or a practice at odds with these standards can be justified on the basis of customary practice, expediency,...
- 15
- 338
- 0
Báo cáo khoa học: The role of evolutionarily conserved hydrophobic contacts in the quaternary structure stability of Escherichia coli serine hydroxymethyltransferase pptx
... 137 Role of hydrophobic contacts in serine hydroxymethyltransferase tion of the fine structure of the CD spectrum However, the CD spectrum of the double mutant holoenzyme (85% dimeric at a concentration ... possible, correlated outcomes of the mutations may be envisaged The decrease of the hydrophobic contact area in the third cluster of CHCs is expected to alter the association of the a-helices that form ... stabilize the structure of the loops and, indirectly, the association between the helices of the cluster This, as a consequence, would reinforce the interaction among the helices and the N-terminal...
- 12
- 578
- 0
Báo cáo khoa học: The essential tyrosine-containing loop conformation and the role of the C-terminal multi-helix region in eukaryotic phenylalanine ammonia-lyases docx
... isolated microsomes from tobacco stems or cell suspension cultures, it has been proposed that metabolic channeling of (E)-cinnamic acid requires the close association of speci c forms of PAL with C4 H ... that the isolated isoforms of the bean PAL after chromatofocusing are enzymes with increasing number of Tyr-loop-out conformations at the four active sites The isoelectric points of these forms can ... 17 A apart from the exocyclic methylene C- atom of the MIO prosthetic group On the basis of the experimental structures, hypotheses on the role of the Tyr110-loop have been put forward One group...
- 16
- 502
- 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx
... internalize as part of a gain -of- function approach to provide insight into the receptor specificity of the B2wt internalization motif The resulting data also hint at a receptor speci c role of the putative ... of GPCRs by second messenger kinases or speci c GRKs is a requirement for receptor sequestration [23] However, the context in which these residues have to appear, or the receptor specificity of ... recognition site because the presence of detergent or membrane lipids influences the formation of a helical structure These authors proposed that activation of the receptor, and subsequently of...
- 12
- 595
- 0
Báo cáo khoa học: Critical role of the plasma membrane for expression of mammalian mitochondrial side chain cleavage activity in yeast pptx
... genomic DNA by amplification using oligonucleotides lip1 (5¢-atagacacgcaaacacaaatacaca cactaaattaataatgaccggatcATGTACTTCCCCTTTTTAGG CAGAT-3¢) and lip2 (5¢-cagtagagacatgggagatcccccgcgg aattcgagctcggtacccgggTCATTCTTTATTTAGAGCATC ... 5¢-TTGTACGAGCTCGG CCGAGCTATACGAAGGCCCGCTACGGCAGTATC GCAcattcacatacgattgacgc-3¢ (nucleotides in lower case are speci c to the KanMX4 module) were used for PCR with pFA6-MX4 as a template [27] to produce the ... gene of CA10 with the KanMX4 cassette, which confers G418 resistance Primers 5¢ATF2-Kan 5¢-AGACTTTCAAACGAATAATAACTT CAGCAATAAAAATTGTCCAGGTTAATtccagcgacatg gaggccc-3¢ and 3¢ATF2-Kan: 5¢-TTGTACGAGCTCGG...
- 13
- 441
- 0
Center for Audit Quality Observations on the Evolving Role of the Auditor: A Summary of Stakeholder Discussions doc
... consequences, in particular how changes to the role of the auditor could impact the role of management and audit committees as the providers of information, specifically with respect to their primary ... Leadership Center Lee Hendrickson, Former Chief Financial Officer, Capitol Bancorp Limited Michele Hooper, President and Chief Executive Officer, The Directors’ Council, and Governing Board Co-Vice Chair, ... Vice President, Controller and Chief Accounting Officer, R.R Donnelley & Sons Company Cindy Fornelli, Executive Director, Center for Audit Quality Cheryl Francis, Co-Founder and Co-Chairman, Corporate...
- 20
- 388
- 0
Báo cáo khoa học: New evidence for the role of calcium in the glycosidase reaction of GH43 arabinanases pot
... that the calcium ion contributes to modulation of the pKa values of the catalytic carboxylates, thus ensuring the protonation equilibrium necessary for enzyme activity Role of calcium in the glycosidase ... coli, but the proteins were not detected The lack of accumulation in vivo indicates poor stability, and suggests that the presence of the C- terminal domain is crucial for the acquisition of the ... present the 3D structure of the wild-type enzyme and describe mutant proteins, providing new evidence for the roles of the calcium cluster observed in the active cleft and particular amino acids...
- 13
- 568
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose