... structure is to demonstrate the aspects ofthe theme: theroleof short- term memory, the relation between short- termmemoryand English to Vietnamese consecutive interpreting andthe suggestions to improve ... need to pay attention more to practice short- termmemory According to the collected data, it reveals that students haven t paid enough attention to practice short- termmemory Therefore, they ... skill In order to obtain the greatest findings and enhance the effectiveness ofthe study, it is scoped with short- termmemoryin English to Vietnamese consecutive interpreting” Methods ofthe study...
... sources of innovation that can provide the impetus for economic development Applying knowledge and forming intellectual capital Nearly two-thirds of National Association of State Universities and Land-Grant ... Collaboration with Other Educational Institutions Partnerships with local and regional educational providers Workforce Development and Training Programs that train students/employees for the workforce ... faculty, staff, student and visitor spending adds to the local economy Universities provide a major stimulus to their state and regional economies, including generating an average return of up to...
... ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ andthe downstream primer containing the EcoRI restriction site ... enzyme) Interestingly, the activity ofthe mutant at elevated temperatures (20–25 °C) exceeded that ofthe wild-type protein Further substitution of His135 by Asp inthe triple mutant W260K/A219N/H135D ... attributed to the presence ofthe Gly cluster in this element The present study supports the idea that the Gly cluster, in combination with its structural environment, is an essential feature of the...
... ACAAAAAYMGSRCRAATCTCCTCRGCTCCTGRTCW AKTATGCTTCCCAGTCCATCTCT-3¢) and g7EcoFor (5¢-AGTGAATTCTCATCTTTGACCCCCAGCGATTAT ACCAA-3¢) As a linker to connect these two, a DNA encoding H49 to L39 with intervening sequences ... Scattered plot of VH and VL interaction against relative affinity ofthe Fv to the antigen The plot is classified by the type of H39, as indicated Fig Scattered plot of OS-fitness against relative ... noncovalently interacting C-terminal constant domains While Fv and its derivatives are widely used, to date no attempt has been made to clarify the effect ofthe interface mutations on the antigenbinding...
... ofthe systems participating inthe TREC evaluation In addition, TREC-9 imposed the constraint that an answer is considered correct only when the textual context from the document that contains ... Portugal into the Hawaiian islands contains two named entities ofthe category L O CATION and both are marked accordingly Step 2: The identication ofthe question concepts The second step identies ... semantic alternation Sometimes these alternations are similar to the relations between multiterm paraphrases and single terms, other time they simply are semantically related terms Inthe case of...
... only the direction ofthe relation is considered, congruity theorists consider both the direction and magnitude ofthe relation Focusing on the strength ofthe relation also draw attention to the ... subsequent effect on relationship realignment and changing brand attitudes To obtain this purpose, it is suitable to use the qualitative data collection method, in- depth interview In addition, the ... makes recipient ambivalence Gift giving situation Gift situation might affect to recipient’s emotions and attitude in different aspects As a starting point for a definition, most theoreticians would...
... for evaluating theroleof Glc6P, we determined the effect of different inhibitor concentrations on the Glc6P content andthe rate of glycogen synthesis in hepatocytes incubated with 15 mm glucose ... effects from studies of glucokinase overexpression [29,30] The aim ofthe present study was to provide a better understanding ofthe contribution of Glc6P to the metabolic effects of glucokinase ... affect the total glucokinase activity, suggesting that changes in protein expression are minimal within this time scale S4048 also did not affect the distribution of glucokinase between the nucleus...
... (particularly theshort ones) have all zeroes in them In other words, none ofthe bigrams from the training set appears in these reviews This suggests that the main problem with the bigram model ... classification To better understand this issue, we again examine a number of test documents Our initial investigation suggests that the problem might have stemmed from the fact that MINIPAR returns ... subsection suggest that our method for extracting objective materials and removing them from the reviews is not effective in terms of improving performance To determine the reason, we examine the...
... the terminal or subterminal position Surprisingly, CYP1 and CYP2 share only 15% amino acid identity and despite their activity towards the terminus of fatty acids, they are not classified into the ... oxidation Although cytochrome P450s not intervene inthe degradation of fatty acids inthe b-oxidation cycle itself, they take part inthe steps preceding b-oxidation (Fig 1) As mentioned inthe ... required for breaking the plant’s defence but, on the other hand, alkanes serve as nutritional input during the initial colonization steps Insect cuticle consists of protein and chitin, and is covered...
... outstanding At the start of each period this firm refinances its debt at the prevailing short- term interest rate, rb (t) If short- term market interest rates are volatile, then the firm’s financing ... fixed-rate obligation to a synthetic floating-rate note The net period t cost of this synthetic note is just the cost of its fixed-rate obligation plus the net cost ofthe swap: Period t cost of synthetic ... volatility in U.S market interest rates, leading them to attribute the rapid growth of interest rate derivatives to the desire on the part of firms to hedge cash flows against the effects of interest...
... barrier of unfolding DGu The distance to the transition state, Dxu, determines the sensitivity ofthe unfolding rate to the pulling force and measures the elongation ofthe protein at the transition ... unfolding the I27 protein in D2O The pulling coordinate for the separating b-strands is defined as the distance between the first amino acid of strand A’ (Y9) andthe last amino acid of strand ... A and B b-strands near the amino terminus ofthe protein domain causes an initial extension ofthe protein, before the unfolding transition state is reached.[53] The hump observed both in the...
... relates to the problem of determining liability for these complex business relationships and protecting against theft and errors The main vulnerabilities stem from the fact that the identity provider ... identities, with a view to strengthening confidence inthe online activities crucial to the growth ofthe Internet Economy The primer is a product ofthe Working Party on Information Security and ... for the Future ofthe Internet Economy” (2008), available at: www.oecd.org/futureinternet The use oftheterm “Internet” is intended to be broad, and reflect the convergence of digital networks,...
... conditions The fact that the raft fractions obtained by the detergentfree method preserved all the biochemical and biophysical properties argues in favour of an effect ofthe detergent on the interaction ... domains (adaptins, transferrin receptor) Another way to study theroleof lipid rafts is to analyze the impact on cell functions ofthe manipulation of their constituents Methyl-b-cyclodextrins, which ... detergent-based methods can abolish the interaction of proteins weakly associated with lipid rafts or provoke the loss of raft proteins that also tightly bind to cytoskeletal components The detergent...
... resistant to proteolytic degradation than bLF-B, the first may also be superior in protection ofthe mammary gland andthe intestinal tract ofthe newborn because it is more resistant to proteolytic ... indicate the migration ofthe protein standards protein band of Mr 41 000 (Fig 8, lanes and 5) We speculated that this fragment of bLF-A represents the N-terminal tryptic fragment with two N-linked ... essential to protect the molecule against trypsin (Fig 4, lanes 1–3) These results contrast with the previous reported roleof N-linked glycosylation inthe protection of hLF against trypsin [19]...
... satisfaction Recall that our hypothesis explicitly stated that we not think that beauty and aesthetics are the only factor that matter to community satisfaction, but rather that they are likely to ... Not at all satisfied Count % % within Count within % % within Count within % % within Count within Extremely Satisfied % % within Count within Total % % within Count within % % within within ... Director ofthe Prosperity Institute of Scandinavia, Jönköping International Business School (charlotta.mellander@jibs.se) Kevin Stolarick Research Director ofthe Martin Prosperity Institute in the...
... denomination of origin labels The survey The survey set out to observe the factors that influence the perception andthe purchasing attitude towards PDO/PGI products, to analyse theroleof labelling ... sample of 400 Italian consumers to observe the factors that influence the perception andthe purchasing attitude towards such products andtheroleof logos on the label in influencing their choices ... housewives Finally, the third cluster groups 21.4% of respondents particularly attentive to the origin of products, quality certifications and to the information contained on the label Indeed, in both...
... two-way t- test Competing interests The author(s) declare that they have no competing interests Authors' contributions BMG carried out the scid vs NOD scid experiments and NK cell cytotoxicity assays ... be the relevant cellular targets whose depletion accounts for CyP's capacity to impair innate resistance to HSV-1 [56,57] Further study is needed to test this hypothesis Roleof Stat in innate ... [27] Therefore, the effect of anti-asialo GM1 and anti-NK1.1 antibodies on host resistance to HSV-1 may be due, at least in part, to their capacity to blunt theT cell response to viral infections...
... glycoprotein in respect to cleavage and transport along the exocytotic pathway To address this question, we investigated inthe present report each potential N-glycosylation site ofthe Lassa ... N-glycan attachment Next we determined the effect ofthe individual N-glycans on the maturation cleavage by analysing the presence ofthe cleaved subunit GP-2 Disruption ofthe N-glycosylation sites ... contributions RE and TS carried out experiments, participated inthe analysis ofthe results and drafted the manuscript OL helped to draft the manuscript and revised it critically WG designed the study,...
... two-way t- test Competing interests The author(s) declare that they have no competing interests Authors' contributions BMG carried out the scid vs NOD scid experiments and NK cell cytotoxicity assays ... be the relevant cellular targets whose depletion accounts for CyP's capacity to impair innate resistance to HSV-1 [56,57] Further study is needed to test this hypothesis Roleof Stat in innate ... [27] Therefore, the effect of anti-asialo GM1 and anti-NK1.1 antibodies on host resistance to HSV-1 may be due, at least in part, to their capacity to blunt theT cell response to viral infections...
... product patents on medicines to comply with the World Trade Organization (WTO) Agreement on Trade Related Aspects of Intellectual Property Rights (TRIPS) The introduction of product patents in India ... suspected of infringing patents inthe countries through which they transit These types of Page of border measures blocked medicines from reaching patients in Africa and Latin America in 2008 and ... content All authors read and approved the final version ofthe manuscript Competing interests The authors declare that they have no competing interests Received: 22 April 2010 Accepted: 14 September...