the return of the repressed in a late socialist city
Tài liệu Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold III; Planar domains " doc
... from the boundary Here small means contained in a small ball 527 PLANAR DOMAINS A “pair of pants” (in bold) Graphical annuli (dotted) separate the “pairs of pants” Figure 4: Decomposing the Riemann ... single-valued over a domain in the plane (as is the case in Theorem 0.3) Combining Theorem 0.3 with the solution of a Plateau problem of MeeksYau (proven initially for convex domains in Theorem of ... graphs fit together and, in particular, prove regularity of the set of points of large curvature – the axis of the double spiral staircase To describe general planar domains (in [CM6]) we need in...
- 51
- 463
- 0
Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt
... expands, the correct denotational relationship is maintained by expanding the image in the table using the ~-expression, and then finding the corresponding element in the model If the element in the ... to a model has been augmented with a table that contains each ~-expression and the ima6e of its denotation in the current stage of the dynamic model When the domain of the ~-expression expands, ... that was the denotation of the h-expression was not expanded in the same way as the image in this table, a new element corresponding to the expanded image is added to the model This table allows...
- 3
- 394
- 0
THE CONSTITUTION OF LAW Legality in a Time of Emergency potx
... to interpreting the laws of apartheid illuminated debates in philosophy of law about the relationship between law and morality My main focus was on the statutory regime put in place to maintain ... understand their relationship in terms of what they share and not in terms of what separates them, since their separation is in the service of a common set of principles The powers are all involved ... of my examples are drawn are the United Kingdom, Canada, and Australia Together they present a fertile ground for testing my claims because, until quite recently, Canada and Australia had what...
- 268
- 661
- 0
THE CONSTITUTION OF LAW Legality in a Time of Emergency docx
... to interpreting the laws of apartheid illuminated debates in philosophy of law about the relationship between law and morality My main focus was on the statutory regime put in place to maintain ... understand their relationship in terms of what they share and not in terms of what separates them, since their separation is in the service of a common set of principles The powers are all involved ... of my examples are drawn are the United Kingdom, Canada, and Australia Together they present a fertile ground for testing my claims because, until quite recently, Canada and Australia had what...
- 268
- 1,134
- 0
Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf
... AACEVAPD1 AACEVAPD3 AACEVAPD2 AACEVAPD5 AACEVAPD4 AACEVAPD6 Vma3p Vma11p Vma16p 100 97 80 80 80 80 50 50 32 100 94 93 93 54 51 28 AACEVAPD5 AACEVAPD2 AACEVAPD3 AACEVAPD1 Table Alignments of the ... preparation of recombinants in yeast expression vector In the case of AACEVAPD1, and 6, TAA is used as an Acetabularia-specific codon usage (translated as Gln) Conversion of TAA to CAA was performed ... because of the lack of assembly of the V-ATPase complex Therefore, vma mutants such as YN45 are not able to accumulate purine intermediates in the vacuole, form white colonies on an agar plate and...
- 8
- 391
- 0
Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks " doc
... π In either case the separation w = π A multi-valued minimal graph is a multi-valued graph of a function u satisfying the minimal surface equation GRAPHICAL OFF THE AXIS 29 x3 -axis One half ... | A| 2 Since the Jacobi equation is the linearization of the minimal graph equation over Σ, analogs of (II.2.8) and (II.2.9) hold for solutions of the minimal graph equation over Σ In particular, ... the lemma The next lemma shows that if an embedded minimal disk Σ in the intersection of a ball with a thin slab is not graphical near the center, then it contains a curve γ coming close to the...
- 43
- 410
- 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt
... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG ... ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ... GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC AATTCTCGAGTGCTGCTGCTGCGAATGCTGC GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG...
- 12
- 512
- 0
modeling of the conduction in a wo3 thin film as ozone sensor
... polycrystalline layer made up of grains which have a great disparity of shape and size In this work, the grains are supposed to be quasi-spherical, identical in size, and single-crystal They are jointed, ... weak and does not involve electronic transfer, the electrons of the atom or the molecule remain located in the vicinity of the adsorbate involving a simple deformation of the orbitals The binding ... spread out between adjacent grains is increased by oxidizing vapours and decreased in the opposite case [6–8], that implies a variation of resistivity in the same way Since 1980, many authors have...
- 8
- 662
- 0
Gynecological Malignancies: Epidemiological Characteristics of the Patients in a Tertiary Care Hospital in India doc
... endometrial carcinoma 56.0 years A study done in Larkana, Pakistan (Siyal et al., 1999) had reported that the average age of the patients with gynecological cancer was 46.5 years and the peak age ... that was with mean of 15.4 years The mean ages at marriage for treated All of them had stated about history of genital ovarian cancer and endometrial cancer cases were 17.0 ulcer of their husbands ... level of the patients (Sarkar et al., 2011), making the management of the disease easier Median value of PCI of family of the patients was Rs 400 and mean value was Rs 543 with a range of Rs 100...
- 8
- 686
- 0
The Art of Grief The Use of Expressive Arts in a Grief Support Group pptx
... meet the needs of the members and the facilitators is the initial planning, organization, and setting up of the group This initial stage can easily be bypassed in the interests of time and the ... logical relationship, and the feelings may come all at once in an inexplicable ball of raw emotion You may hear complaints of fatigue, exhaustion, lack of energy, pain, or inability to sleep All of ... Grief and the Sacred Art of Ritual Janet Shaw Rogers 129 Section III Alternative Art Forms, Programs, and Stories of Art and Healing Chapter 14 The Painters Deborah Koff-Chapin, Carol McIntyre, and...
- 324
- 639
- 0
Báo cáo khoa học: The consensus motif for N-myristoylation of plant proteins in a wheat germ cell-free translation system ppt
... yielding pTA2–AGG1 The coding region for mature AGG1 fused with a DNA fragment encoding the myristoylation motif Met-Gly-Ala-Ala-Ala-Ala-Ala-AlaAla-Ala or Met-Gly-Ala-Ala-Ala-Ser-Ala-Ala-Ala-Ala ... myristoylation motifs Met-Gly-Xaa-Ala-AlaAla-Ala-Ala-Ala-Ala (Myr–AGG1-3X 6A) or Met-Gly-Xaa-Ala-Ala-Ser-Ala-Ala-Ala-Ala (Myr–AGG1-3X6S) (B, C) Each of the 20 mRNAs corresponding to Myr–AGG1-3X 6A (B) ... N-terminus to the myristoylation motifs Met-Gly-Xaa-Ala-Ala-Ala-Ala-Ala-Ala-Ala (Myr–AGG1-3X 6A) or Met-Gly-Xaa-Ala-Ala-Ser-AlaAla-Ala-Ala (Myr–AGG1-3X6S), with position of each motif separately occupied...
- 12
- 473
- 0
not a suicide pact the constitution in a time of national emergency sep 2006
... rather than creative But both the literal and intended meaning of the original text may have been abandoned in the process For reasoning by analogy is slippery Invariably there is a choice of ... default find themselves making decisions in much the same way that other Americans do—by balancing the anticipated consequences of alternative outcomes and picking the one that creates the greatest ... sense of what the case is about and what the statute is about before starting to parse the statute Judicial bias in the pejorative sense means taking account of considerations, such as a litigant’s...
- 186
- 1,003
- 0
báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot
... clinical training skills and advanced training skills, as well as the number of trainings each clinical trainer and advanced trainer had conducted since the training http://www.human-resources-health.com/content/7/1/11 ... pursue additional training in instructional design to become a master trainer, which is the "top" of the trainer pathway Master trainers are able to design trainings and conduct advanced training ... take a collaborative approach to increasing VCT services and training capacity throughout the region A strong sense of leadership within the new cadre of VCT advanced and master trainers was another...
- 8
- 450
- 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
... draft the manuscript AlexP participated in the design of the study and drafted the manuscript Both authors read and approved the final manuscript Acknowledgements 18 19 The authors thank Prof ... recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the lower fitness of the ... nonpairing C /A bases in the minus-sense RNA Interestingly, in Puumala hantavirus, a hairpin-like structure formed by a highly conserved inverted repeat in the 3'-noncoding region of the S segment...
- 5
- 483
- 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt
... draft the manuscript AlexP participated in the design of the study and drafted the manuscript Both authors read and approved the final manuscript Acknowledgements 18 19 The authors thank Prof ... recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the lower fitness of the ... nonpairing C /A bases in the minus-sense RNA Interestingly, in Puumala hantavirus, a hairpin-like structure formed by a highly conserved inverted repeat in the 3'-noncoding region of the S segment...
- 5
- 430
- 0
báo cáo hóa học:" Quality of life and the impact of drug toxicities in a South African community-based antiretroviral programme" docx
... South Africa, there is an ongoing debate about whether or not the side-effect profile of HAART may adversely affect the HRQoL of HIVpositive individuals More data about the impact of HAART and HAARTrelated ... onto HAART and increasing survival among these patients, there is a growing need to understand the impact of HAART use on the quality of lives of HIVinfected individuals [4-8] There is a sizeable ... antiretroviral (ARV) therapy progressed to AIDS and died of their disease The rollout of highly active antiretroviral therapy (HAART) through national and provincial programmes has dramatically altered...
- 13
- 444
- 0
Báo cáo hóa học: " Research Article Fixed Point Methods for the Generalized Stability of Functional Equations in a Single Variable" ppt
... transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 Z Gajda, “On stability of additive mappings,” International Journal of Mathematics and Mathematical Sciences, vol ... functional equation,” Proceedings of the National Academy of Sciences of the United States of America, vol 27, no 4, pp 222–224, 1941 T Aoki, “On the stability of the linear transformation in Banach ... Ulam,” Journal of Approximation Theory, vol 57, no 3, pp 268–273, 1989 T M Rassias, “On the stability of the linear mapping in Banach spaces,” Proceedings of the American Mathematical Society,...
- 15
- 362
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25