the paint utility provides a few rudimentary tools for working with image files
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc
... acts at somatodendritic nAChR in the substantia nigra pars compacta and at presynaptic nAChR in the striatum (B) a- Conotoxin MII was one of the first antagonists that differentiated pharmacologically ... ease of synthesis, makes AuIB is present in intracardiac ganglia, or that the a3 b4* them particularly useful templates for the design of receptors in intracardiac ganglia form a substantially optimized ... MS analysis and assay-directed fractionation [83] It has subnanomolar potency at the a3 b2 nAChR and is 200-fold less active on the a7 nAChR (Table 1) AnIB is sulfated at tyrosine 16 and has,...
- 15
- 757
- 0
Báo cáo hóa học: " Neuraminidase activity provides a practical read-out for a high throughput influenza antiviral screening assay" pptx
... Ribav irin concentration microM Figure the AVINA amantadine against influenza A and B viruses in Titration of assay Titration of amantadine against influenza A and B viruses in the AVINA assay ... cells in an AVINA assay that measured sensitivity to amantadine Virus generated after a single passage in the presence of amantadine was slightly less sensitive to amantadine than the original stock; ... development of the AVINA assay, a high throughput assay that measures NA activity as a read-out for virus replication The advantages of this assay are its ease of execution, reproducibility, and sensitivity...
- 8
- 297
- 0
báo cáo hóa học:" Research Article Note on the Persistent Property of a Discrete Lotka-Volterra Competitive System with Delays and Feedback Controls" pptx
... Gopalsamy, Stability and Oscillations in Delay Differential Equations of Population Dynamics, vol 74 of Mathematics and Its Applications, Kluwer Academic Publishers, Dordrecht, The Netherlands, ... LotkaVolterra competitive system with delays and feedback controls,” Journal of Computational and Applied Mathematics, vol 211, no 1, pp 1–10, 2008 S Ahmad, “On the nonautonomous Volterra-Lotka ... competition equations,” Proceedings of the American Mathematical Society, vol 117, no 1, pp 199–204, 1993 S Ahmad and A C Lazer, “On the nonautonomous N-competing species problems,” Applicable Analysis,...
- 9
- 351
- 0
Báo cáo hóa học: " Research Article The Personal Hearing System—A Software Hearing Aid for a Personal Communication System" ppt
... example, the iPhone [8] or the GooglePhone [9] These devices can act as a central processor for hearing aids with access to binaural audio information and the advantage of increased processing performance ... aids Another factor that influences and might facilitate the further development of hearing support systems is the availability of standard hardware and open software for mobile devices, for example, ... framework for hearing aid algorithms Another hardware-related factor is the development of Wireless Body Area Networks (WBANs) that can be seen as an enabling technology for mobile health care...
- 9
- 405
- 0
Báo cáo lâm nghiệp: " Variation of the photosynthetic capacity across a chronosequence of maritime pine correlates with needle phosphorus concentration" pptx
... age Figure Relationship between maximum carboxylation rate, Vcmax, and phosphorus concentration on a leaf area basis, Pa, across the chronosequence For each stand, value represents the mean and ... idea that Vcmax and Jmax not correlate with the age decline in forest productivity For instance, Barnard and Ryan [1] found that Eucalyptus saligna trees of 1- (7 m) and 5-years (26 m) had Vcmax ... climate and soil characteristics) and management practices The climate is temperate maritime with cool wet winters and warm dry summers Mean annual temperature (1950–2000) was 13 °C, and mean annual...
- 7
- 321
- 0
Báo cáo y học: "Left ventricular diastolic dysfunction of the cardiac surgery patient; a point of view for the cardiac surgeon and cardio-anesthesiologist" pptx
... ventricle can be intraoperatively diagnosed, estimated and graded by using Trans Oesophageal Echo (TOE) Moreover, valuable information may be obtained with the additional use of a Swan-Ganz catheter ... derived variables (left ventricular end-diastolic area, peak blood velocity variation), but some information can be derived by the Swan-Ganz catheter as well (PCWP and peak pulmonary pressure variation) ... persist, at least for the first three postoperative hours after coronary artery bypass grafting [48,49] In a similar way, Yamamoto et al by using classical ECHO after coronary artery bypass grafting,...
- 10
- 490
- 0
báo cáo khoa học: "Collaborative planning approach to inform the implementation of a healthcare manager intervention for hispanics with serious mental illness: a study protocol" pptx
... dominant language (e.g., Spanish) to reduce language barriers and drafting all patient educational materials at the appropriate reading level (e.g., fourth grade) to enhance health literacy Surface ... Scientific Software Development GmBH, Berlin, Germany), a qualitative data management software [58], will be used to manage and analyze all qualitative data Quantitative analysis All tests will ... discussed with the CAB to inform next steps and future plans Data analysis Quantitative data entry and analysis will utilize SAS version 9.1.3 (SAS Institute, Inc., Cary, NC, USA) ATLAS ti (ATLAS.ti Scientific...
- 12
- 423
- 0
Báo cáo y học: "Distinctive receptor binding properties of the surface glycoprotein of a natural Feline Leukemia Virus isolate with unusual disease spectrum" pps
... each case is underlined: 1) the mutant designated 61E/945-5 using primer 5’ACTAGTGTTGGATCCTAACAACGTTCGGCATGGAGCTAGGTATAGCAGTAGCAAATATGGATGTAAAACTACAGATAG-3’, 2) the mutant designated VRB3aa using ... 5’-GAGGGAGTAATCAGGACAATAGCTGCACAGGAAAATGCAACCCCC-3’, 3) the mutant designated N147S using primer 5’-GGGAGTAGTCAGGACAATAGCTGTGAGGG-3’, 4) the mutant designated K128N/S130T using primer 5’GCAACCCCCTAGTCTTACAGTTCACCCAGAAGGGAAGACAAGCCTCTTGG-3’, ... 5’GCAACCCCCTAGTCTTACAGTTCACCCAGAAGGGAAGACAAGCCTCTTGG-3’, 5) the mutant designated I156V/K164R using primer 5’-GGAGAAGCTTGGTGGAATCCCACCTCCTCATGG-3’, and 6) the mutant designated I186V using primer 5’GGATATGACCCTGTCGCTTTATTCACGGTGTCCCGGCAGG-3’...
- 17
- 267
- 0
Báo cáo y học: "Carpal tunnel syndrome and the "double crush" hypothesis: a review and implications for chiropractic" pps
... chiropractic care of CTS (Table 1), and only Mariano et al [38] claimed a patient to have had a case of DCS Diagnosis of cervical radiculopathy was based on pain in the neck and upper back, pain radiating ... 10:365-369 Baba H, Maezawa Y, Uchida K, Furusawa N, Wada M, Imura S, Kawahara N, Tomita K: Cervical myeloradiculopathy with entrapment neuropathy: a study based on the double-crush concept Spinal Cord ... fibers (as manifested by abductor pollicus weakness and EMG findings) Another possibility is that the Mariano case actually was cervical radiculopathy, alone Alternatives to the Upton and McComas'...
- 9
- 347
- 0
designing and implementing a neural network library for handwriting detection, image analysis etc
... first you train the network with a number of samples You provide an XRay, along with the information that whether that particular X-Ray has a fracture or not After training the network a number ... in a back ward propagation neural network In a backward propagation neural network, there are several layers, and each neuron in each layer is connected to all neurons in the next layer For each ... understand Also, a neuron has a bias value, which affects the net value A bias of a neuron is set to a random value, when the network is initialized We will change the connection weights and bias...
- 20
- 415
- 0
báo cáo hóa học: " A flexible routing scheme for patients with topographical disorientation" potx
... from architectural drawings A patient table captures vital information about the patient, namely, personal data such as name, age, sex, contact information, and most importantly, individual ability ... conventional implementations that rely on a static graph, our approach uses a dynamically changing graph Recall that there is a navigational choice at each node Whenever the user reaches a new node, the ... turn Database Information pertaining to patient disability, the building layout and environmental barriers along paths of travel are organized into a relational database consisting of three tables...
- 11
- 545
- 0
báo cáo khoa học: " Primary care provider preferences for working with a collaborative support team" potx
... full- and part-time staff PCPs agreed to participate in SEACAP Twenty (48%) of these PCPs had previously participated in a randomized trial of a collaborative approach to depression Participating ... implementation phase of care management was positively associated with subsequent attitudes and participation in care management activities [12,21] However, this study also indicated that active participation ... participation of clinicians in the development phase was negatively associated with subsequent attitudes and participation Appendix A Survey of PCP preferences for the assistance with pain treatment...
- 6
- 271
- 0
Narrowband photon pairs from a cold atomic vapour for interfacing with a single atom
... work with him and Sandako while doing HOM measurements Gleb, for always teasing me I still miss that Dzmitry, for his great ideas One can approach him anytime and any day and he is always ready ... residual pump light The pump beams can be adjusted to any value from a linear to circular polarization using Polarizers (P), quarter wave plates (q) A pair of quarter wave plates (q), half wave plates ... Magneto-Optical Trap set up: a glass cuvette attached to a vacuum chamber, quadruple coils and circular polarized beams used for cooling the atoms The MOT is formed at the intersection of the cooling beams...
- 124
- 299
- 0
162 Tips and Tricks for Working with eLearning Tools
... the step to take We alternate events with narration, rather than doing them at the same time The main reason for this is that a product like Captivate will separate the simulation into separate ... self-contained within a slide This also makes it much easier to replace the amateur audio with professional narration later Steps like these can save you a lot of headaches! – 53 Captivate, Adobe: The ... documentation becomes essential .The information gathered,and decisions made at the different phases,are the building blocks for the final proposal you will make to management 7.To conclude,an evaluation...
- 65
- 585
- 0
Tài liệu Báo cáo khoa học: "The Utility of a Graphical Representation of Discourse Structure in Spoken Dialogue Systems" ppt
... addition, the SIH is not always available and users have to activate it manually Other visual improvements for dialogue-based computer tutors have been explored in the past (e.g talking heads (Graesser ... was enhanced to display the correct answer after the system is done with each question We extracted the correct answer from the system specifications for each question and manually created a ... (NM) and it is easier for them to criticize the second problem (noNM) Other factors that can blur the effect of the NM are domain learning and user’s adaptation to the system Integration Q9 and...
- 8
- 515
- 0
A COMPARATIVE STUDY OF THE DIAGNOSIS OF PULMONARY TUBERCULOSIS USING CONVENTIONAL TOOLS AND POLYMERASE CHAIN REACTION* pot
... culture and PCR The data were compared with available clinical information Radiological data was available from 61 subjects The study was conducted blind The purpose of this study was to determine the ... less than 48 hours whereas results for culture were available 4-8 weeks later As no single gold standard was available for comparison of the performance of the individual tests, an analysis of ... culture and PCR Sample processing, culture and PCR KAVITA MODI – PAREKH ET AL weeks Characterization of Mycobacteria was done at the Corporation laboratory by primary differential tests for atypical...
- 8
- 524
- 0
Báo cáo khoa học: "Multilingual WSD with Just a Few Lines of Code: the BabelNet API" pdf
... lexical knowledge base, along the lines of Navigli and Lapata (2010) At its core, the API leverages an in-house Java library to query paths and create semantic graphs with BabelNet The latter ... bilingual parallel corpora for crosslingual textual entailment In Proc of ACL-11, pages 1336–1345 Rada Mihalcea, Ravi Sinha, and Diana McCarthy 2010 SemEval-2010 Task 2: Cross-lingual lexical substitution ... (bn:02945246n) and E TH ICAL BANKING (bn:02854884n, from Italian) An API for multilingual WSD BabelNet API BabelNet can be effectively accessed and automatically embedded within applications by means of a...
- 6
- 400
- 0
Báo cáo khoa học: "SOFTWARE TOOLS FOR THE ENVIRONMENT OF A COMPUTER AIDED TRANSLATION SYSTEM" pptx
... directly accessed on the screen But the translation is always done by the translator This data base is composed of dictionaries, "formats" and "procedures" of the analysis, transfer and synthesis phases ... help translators in several ways, particularly with Machine Aided Human Translation (MAHT) The translator is provided with a text editing system, as well as an uncoded dictionary which may be ... phases (the conventional phases of a CAT system) For any given source lexical unit in this data base, VISULEX searches for all the associated information THAM consists of a set of functions programmed...
- 4
- 404
- 0
The Marketing Data Box - A QUARTERLY COLLECTION OF PRACTICAL MARKETING TOOLS READY FOR PROFESSIONAL USE doc
... from major data partners and captures essential marketing data over the short term for a fast, easy glance at trends The charts in this collection are ready to use, download, format, and otherwise ... Cable TV Spot TV Spanish Syndication – Language TV National The Marketing Data Box Ad Spend for Radio Up 7% Ad Spend for Radio Media 2009 v 2010, % change Source: Kantar Media Strong showing for ... Arbitron RADAR 107 2.2% Radio media total Local radio National spot radio Network radio The Marketing Data Box Newspapers: Negative and Slow Ad Spend for Newspaper Media 2009 v 2010, % change Source:...
- 65
- 329
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008