the on line coupled mesoscale climate chemistry model mccm a modelling tool for short episodes as well as for climate periods
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt
... 2xi are not described as single reactions in our formalism, as stoichiometry b would exceed one What remains for a1 is all the reactions that have xi as the substrate and not as the product Therefore, ... equal, canceling the negative subgraph with a positive graph of the same absolute value (see below for an example) Therefore, only damped oscillations can be obtained in such a case Additional ... for the steady state condition to be satisfied For the same reason, all the biochemical schemes involving a negative graph of second order can only induce damped oscillations Damped oscillations...
- 11
- 638
- 0
Báo cáo khoa học: The highly conserved extracellular peptide, DSYG(893–896), is a critical structure for sodium pump function docx
... Asp893fiAla 5¢-GTGGAGGCCAGCTATGGGCAGCAG-3¢ Ser894fiAsp 5¢-GTGGAGGACGACTATGGGCAGCAG-3¢ Ser894fiIle 5¢-GTGGAGGACATCTATGGGCAGCAG-3 Gly896fiArg 5¢-GTGGAGGACAGCTATAGGCAGCAG-3¢ Gly896fiIle 5¢-GTGGAGGACAGCTATATCCAGCAG-3¢ ... constructs between the a subunits of Na+/K+-ATPase and the gastric H+/K+ATPase [26] This segment was also demonstrated to be important for ion conduction, as shown for Asp884 and Asp885 mutants ... antigen/antibody/protein-G + agarose complex was sedimented at °C by centrifugation for s at 900 g, and the supernatant was removed by aspiration The pellet was then washed, essentially as described above, for the immunoprecipitation...
- 11
- 318
- 0
Báo cáo y học: "A web tool for finding gene candidates associated with experimentally induced arthritis in the rat" docx
... Comparison of manual evaluation with CGC ranking To estimate the ability of the CGC application to rank candidate genes in a fashion similar to human evaluation, an independent manual inspection ... created the rat/human comparative database, implemented it in the CGC application and drafted the manuscript PJ had main responsibility for all supporting functions of the application and was ... Comparing the manual and CGC ratings, it was found that the two highest-ranked candidate genes in the CGC application for all QTLs studied were rated as high in the manual evaluation, with the...
- 8
- 415
- 0
A visualization tool for the rapid analysis of bacterial transcriptome data pot
... as dataextraction and conversion algorithms, which are summarized in Table The combination of visualization and information extraction allows subsequent rounds of analyses, and thus an increase ... that enables visualization of transcriptome data onto a linear map of an annotated bacterial genome and at the same time highlights additional features, such as putative regulatory sequences and ... 2003:29-40 Kanehisa M, Goto S, Kawashima S, Nakaya A: The KEGG databases at GenomeNet Nucleic Acids Res 2002, 30:42-46 Karp PD, Riley M, Paley SM, Pellegrini-Toole A: The MetaCyc Database Nucleic Acids...
- 6
- 510
- 0
báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt
... NorthStar is an integrated and practical tool to assist QI researchers, healthcare professionals, and managers responsible for developing, delivering and evaluating CE and QI programmes at a national ... browser-based version and an HTML help file version, and will soon be available in French and Italian, as well as English While the focus of NorthStar is on QI programmes at a national or regional level, ... NorthStar is a major product of the ReBEQI project It is a software program that packages information on the design and evaluation of evidence-based QI interventions into an integrated, easily accessible,...
- 7
- 429
- 0
Báo cáo sinh học: " Jane: a new tool for the cophylogeny reconstruction problem" ppt
... either Tarzan or a Nexusbased format A file must specify the host and parasite trees and the tip associations Optionally, the file can specify time zones or time zone ranges as well as regions ... such a timing, see a graphical representation of the solution, and modify the solution by clicking on a parasite association on the host tree and moving it elsewhere on the host When the parasite ... the graphical user interface but can be set in the command -line version of Jane Values of these parameters were systematically evaluated and the best values found are used as defaults Jane can...
- 10
- 551
- 0
Báo cáo y học: "Validation of the Arab Youth Mental Health scale as a screening tool for depression/anxiety in Lebanese children" ppt
... region The validation revealed that the AYMH scale has reasonably good construct validity and internal consistency However, the scale has moderate discriminatory capabilities as a diagnostic tool for ... check the equality of variance assumption Internal consistency of the scale was evaluated using Cronbach’s alpha As for validity analysis, the diagnostic assessment of depression and anxiety by the ... Health (AYMH) scale as a screening tool for CMDs among Arabic-speaking youth The AYMH scale was developed as part of a large community-based participatory intervention to improve the mental health...
- 7
- 386
- 0
Báo cáo y học: "The Utstein template for uniform reporting of data following major trauma: A valuable tool for establishing a pan-European dataset" docx
... combination of such databases, the management of missing data and the sensible exploration of large-scale data For now, both approaches are valid A robust, clearly defined core dataset common to all ... product administration can all be tagged electronically, as can the patient's position within the hospital Other databases, such as ICU, pathology and radiology systems already collect much of the ... Important for this will be legislative policy at national and European levels to support the development of an informatics infrastructure for trauma and the collection of such data on a population-wide...
- 2
- 246
- 0
Báo cáo y học: " L2L: a simple tool for discovering the hidden significance in microarray expression data" pdf
... shows that, at least for the diabetic nephropathy dataset on the U95Av2 platform, a simple calculation of p values based on the binomial distribution gives a good approximation of the actual likelihood ... microarray data from disparate platforms has been recognized for several years A consortium of researchers [7] has detailed a standardized format for presenting microarray data (MAIME) [8] as well ... with random data was no greater than 0.05 for any list in the database, and as low as 0.001 (see supplemental data on the L2L website [6]) In the absence of common systematic bias, therefore, random...
- 18
- 289
- 0
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 1084 CTT1F AAAGAGTTCCGGAGCGTGTA 1279 NPT1 3' CAGGGTGTGGAAGAACAGGT ... such that genes whose expression patterns are similar across the time course cluster together Pearson correlation was used as the similarity measure and average linkage as the clustering algorithm...
- 17
- 432
- 0
Báo cáo nghiên cứu khoa học " On the seasonal prediction of surface climate over Vietnam using Regional Climate Model (RegCM3) " ppt
... with negative mean errors at almost all stations except Sapa ME AnthesKuo Emanuel Grell LAICHAU DIENBIEN SONLA MOCCHAU YENCHAU HAGIANG BACQUANG SAPA BAICHAY LANGSON TUYENQUAN YENBAI THAINGUYEN ... TUYHOA NHATRANG PHANRANG PHANTHIET PHUQUY KONTUM PLAYCU AYUNPA BUONMATHU DACNONG DALAT BAOLOC VUNGTAU CANTHO RACHGIA CAMAU CONDAO TRUONGSA PHUQUOC -3 -6 -9 -12 Station Figure Mean error of monthly ... NAMDINH NINHBINH BACHLONGVI THAIBINH HOIXUAN THANHHOA TUONGDUON HATINH HUONGKHE KYANH TUYENHOA DONGHOI DONGHA VINH HUE ALUOI NAMDONG DANANG TRAMY QUANGNGAI BATO QUYNHON TUYHOA NHATRANG PHANRANG...
- 8
- 375
- 0
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx
... both environmental factors such as UV radiation and physiological stress such as starvation may affect this supraorganization are also presented MATERIALS AND METHODS Chemicals Reagent-grade phosphoric ... centrifugation as before and the supernatant was spun at 148 000 g in a TFT 50.38 Kontron centrifuge at °C [16] The supernatant was collected and used for HPLC separation without any further purification ... charge Once M and z are determined for one pair of peaks, all other m/z signals can be deconvoluted into one peak on a real mass scale, which has a typical peak width at half height of 10–20 average...
- 9
- 477
- 0
REPORT of the CAS WORKING GROUP on ENVIRONMENTAL POLLUTION and ATMOSPHERIC CHEMISTRY docx
... gases are being activated The World Data Centres, in particular on ozone and UV at the Meteorological Service of Canada, Toronto, and on greenhouse gases (as well as other gases) at the Japan Meteorological ... different GAW parameters on a global basis and become a “one stop data warehouse” for GAW station network information and bridge the gaps between WDCs 9.13 Appreciation to organizations and groups participating ... FACING THE GAW PROGRAMME GAW ORGANIZATIONAL COMPONENTS 4.1 SAGs and QA/SACs 4.2 An Example QA/SAC: Swiss QA/SAC EMPA 4.3 Data Management (GAWSIS and the World Data Centres) 4.4 Communications (GAW...
- 28
- 435
- 0
Báo cáo khoa học: "On-line Language Model Biasing for Statistical Machine Translation" docx
... not available for E2D LM training data in words: 2.4M (Dari), 3.4M (Pashto) 4.1 Data Configuration Parallel data were made available under the Transtac program for both language pairs evaluated ... translation for each source sentence For E2P, DARPA has made available to all program participants an additional evaluation set with multiple (four) references for each test input The Dari and ... Statistical phrase-based translation In NAACL ’03: Proceedings of the 2003 Conference of the North American Chapter of the Association for Computational Linguistics on Human Language Technology, pages...
- 5
- 311
- 0
Báo cáo khoa học: "THE GENERATION OF TERM DEFINITIONS FROM AN ON-LINE TECHNOLOGICA" pot
... consistency in a very large data base In the complex case, where there are perhaps several terms having the same relationship as the input term to a common 'head', or where the 'head' may have several sub-groups ... information on the actual character strings of terms Most of the field values are self-explanatory The FATF/~/BROTHER field has a dual value (indicated by an appropriate flag) and together with the SON ... SON VARIANT CONTENT ALT~ATIVE FLAGS The FACET field takes its nsn~ from the facets well- known in the construction of DTs A facet is here used in a similar manner to a DT facet, that is, as a...
- 6
- 309
- 0
Báo cáo sinh học: "Comparison between 68Ga-bombesin (68Ga-BZH3) and the cRGD tetramer 68Ga-RGD4 studies in an experimental nude rat model with a neuroendocrine pancreatic tumor cell line" ppt
... (internalization) 68Ga-DOTATOC was better suited than 18F-FDG for the diagnosis of metastatic NETs The 68 Ga-DOTATOC uptake was also used as a parameter for a radionuclide therapy with 90 Y-DOTATOC ... evaluation was performed with Stata/SE 10.1 (StataCorp, College Station, TX, USA) Statistical evaluation was performed using the descriptive statistics and scatter plots The classification analysis ... quality of the data and model fit using nonlinear regression and two-tissue-compartment model Table presents the mean, median, minimum, and maximum values as well as the standard deviation for the SUV,...
- 23
- 350
- 0
Báo cáo hóa học: " Neumann problem on the semi-line for the Burgers equation" pdf
... (2002) Fokas, AS: On the integrability of linear and nonlinear partial differential equations J Math Phys 41, 4188–4237 (2000) Fokas, AS, Pelloni, P: Two-point boundary value problems for linear evolution ... Fokas, AS: A unified transform method for solving linear and certain nonlinear PDEs Proc R Soc Lond A 53, 1411–1443 (1997) Degasperis, A, Manakov, SV, Santini, PM: On the initial-boundary value ... method, the Neumann problem on the semi -line for the Burgers equation has not received much attention in the literature in the past To the best of the authors’ knowledge, Theorem (as well as Lemma...
- 10
- 345
- 0
Báo cáo hóa học: " On the solvability of a boundary value problem on the real line" pdf
... 2.4) applies, provided that the operator F also satisfies the other required assumptions Similar considerations can be done for the p-Laplacian operator too, using Theorem 2.5 Author details Dipartimento ... in contradiction with (2.18) From here on, the proof proceeds in the same way □ In the particular case of p-Laplacian operators, one can use the positive homogeneity for weakening assumption (2.17) ... Ancona, Italy Authors’ contributions The authors wrote this article in collaboration and with same responsibility All authors read and approved the final manuscript Competing interests The authors...
- 17
- 409
- 0
báo cáo hóa học:" Research Article Unbounded Solutions of Second-Order Multipoint Boundary Value Problem on the Half-Line" potx
... R is a Banach space with the norm · ∞ see 17 The Arzela-Ascoli theorem fails to work in the Banach space E due to the fact that the infinite interval 0, ∞ is noncompact The following compactness ... Funkcialaj Ekvacioj, vol 36, no 3, pp 557–579, 1993 14 M Meehan and D O’Regan, “Existence theory for nonlinear Fredholm and Volterra integral equations on half-open intervals,” Nonlinear Analysis Theory, ... solutions of boundary value problems on the half -line, ” Journal of Mathematical Analysis and Applications, vol 259, no 1, pp 127–136, 2001 21 C Bai and J Fang, On positive solutions of boundary value...
- 15
- 225
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25