the move to a new complex structure is based on three design choices increasing vertical differentiation increasing horizontal differentiation and increasing integration 8
... evaluation, common in the machine translation domain and already used for paraphrase evaluation (Bannard and Callison-Burch, 2005) The question asked tothe human evaluator for the syntactic task is: ... sentences as a test corpus 4.2 SMT Language model and paraphrase table Paraphrase generation tools basedon SMT methods need a language model anda paraphrase table Both are computed ona training ... propose a variation of the UCT algorithm for paraphrase generation named MCPG for MonteCarlo based Paraphrase Generation The main part of the algorithm isthe sampling step An episode of this step is...
... this molecular mass change is too small to explain the dimerization of the bc1 complex at this stage (i.e just after the addition of ISP and Qcr10p) 1910 Onthe other hand, in the transition ... mitochondria only when the mild detergent digitonin was used (lane 1) By contrast, Triton X-100 caused the disappearance of the two supercomplexes of 1000 and 85 0 kDa, leaving unaltered only the ... macromolecular organization of the mitochondrial proteome, comparatively little is known about the assembly pathway leading tothe maturation of the cytochrome bc1 complex in the inner mitochondrial membrane...
... you visit may not function as they normally • Disable options to always set cookies A cookie isa file placed on your computer that stores website data Attackers may be able to log onto a site ... firewall is enabled, consult the user’s guide to learn how to configure the security settings and set a strong password to protect it against unwanted changes Install and Use Antivirus and Antispyware ... malware New malware is discovered daily, and vendors frequently make new signatures available, so antivirus software will be most effective if the signatures are up to date Many antivirus and antispyware...
... clinically important difference” Authors’ contributions All the authors contributed substantially tothe conception anddesign of the protocol andtothe acquisition, analysis and interpretation ... participated in the conception anddesign of the study andthe revision of the manuscript NT and SB carried out the patients’ enrolment andthe data collection DR conceived and designed the study ... (proportions, means and standard deviations) were used to describe the study population at baseline Chi-square and t-tests were used to compare the baseline characteristics of the “treatment” and “control”...
... Oklahoman GR AN D CAN YON N ATION AL PARK F lags taf ARIZONA Phoenix Tucson “If the church is going to make a difference in the world today, changes have to be made The theology that we preach and ... ockt on San Jose YOSEMI TE N ATI ONA L PAR K K INGS CA NYON N AT ION AL PAR K Fres no SEQU OIA NATI ONA L PAR K D EATH VALL EY N AT ION AL M ON UM EN T C ALIFOR N IA Pas adena Los Angeles San Bernardino ... findings and insights about the Bible and Christianity They want to keep re-examining their beliefs and revising them when new information or insight seems to make revision necessary They want to hear...
... such an approach is lacking, but the area has been identified as a research priority Anew paradigm for podiatrists focuses on combination therapy targeted at inflammatory lesions and associated ... for the management of rheumatoid arthritis [73] Arthritis and Musculoskeletal Alliance Standards of care for people with inflammatory arthritis [74] Podiatry Rheumatic Care Association Standards ... foot disease state or remission Care can then be escalated or tapered basedon monitoring foot disease and related impairment and disability using a number of clinical metrics These are summarised...
... 8. 64 years (range - 16) at t1 and M = 9.16 years (range - 16) at t2 The Tanzanian and German board of the organization managing the orphanage gave their consent and ethical approval Materials The ... out the second assessment, performed the statistical analyses, and drafted the manuscript TH carried out the second assessment, performed the statistical analyses and helped to draft the manuscript ... assessment, interviewers and translators stayed in the orphanage and shared the meals with the children and played with them in their free time Analyses All variables except one met the preconditions...
... MODELS Notation Usually capital letters (e.g Ui and U) are used as the notation for a random variable or a random vector; and lower case letters (e.g u i and u) are used as the notation for a specific ... data) + Varv|data E (ai |v, data) the first term Ev|data Var (ai |v, data) = Ev|data Var (ai |v) (because p (ai |v, data) = p (ai |v), which follows from the conditional independence of and data ... reliability of a linear predictor of a random effect (a linear predictor basedon survival data or transformed survival data) others are just ratios of variances and others are more difficult to...
... Server are loaded into the Databases list box The user can then select a database from the list When the user does this, the Connect button is enabled If the user then clicks onthe Connect button, ... in the same listing to False This How -To is great for exactly what it does: letting the user (or administrator) pick anew SQL Server and database to connect to if necessary You can then save ... routine called LoadSQLServers After establishing an instance of the SQL-DMO application, the code calls the ListAvailableSQLServer method If no names are loaded into the oNames namelist object (meaning...
... around $1 million a year." Needless to say, you'll need to back up that claim with additional facts and success stories However, rather than telling the customer that your product is "exciting" ... whether your sales message is any good Print it out and, with a red pen, circle every adjective and adverb (i.e telling) Then underline any facts that might actually spark an emotional response ... rewrite the message so that it shows rather than tells Here's a real life example: By editing out the biz-blab and showing rather than telling, we end up with the following message, which is far more...
... declare a variable – we call this initializing a variable Or you can read a value from a file or the keyboard Homework: Write a program to find the average of three grades for a student Display the ... calculates area and perimeter of a circle In this program, I have placed all file related code in one separate section ***** Program: By: Calculate area and perimeter of a Circle Dr John Abraham Prepared ... Place any character stream you want in this file by using the
... dollars to change -> "; Displays the prompt tothe user cin >> dollar; Waits for the user to type in a value at the keyboard When a value is entered, that value is stored in the memory location ... problem What are the known information about this programming assignemnt? There are ten dollars in a quarter roll There are five dollars in a dime roll There are two dollars in a nickel roll And there ... of the program as follows, save it tothe appropriate subdirectory If you are using the campus computer, save to c:\temp\yourfilename.cpp Replace yourfilename with whatever name you want to call...
... National Laboratory, Lawrence Berkeley National Laboratory, Sandia National Laboratories, Los Alamos National Laboratory, National Renewable Energy Laboratory, Argonne National Laboratory, Oak ... engines A manufacturing team, an electrical and electronics power-conversion devices team, a materials and structures team, anda systems analysis team are also part of the PNGV organization (NRC, ... dedicated tothe furtherance of science and technology andto their use for the general welfare Upon the authority of the charter granted to it by the Congress in 186 3, the Academy has a mandate that...
... and accomplishments to help you make a dynamic, professional presentation to your connections, to hiring managers, andto recruiters A VisualCV is not only professional; it's quick and easy to ... clearly William Arruda, founder of Reach, the global leader of personal branding, author of Career Distinction and curator at personalbranding.tv explains, "An important element of your brand is ... attract professionals for their open positions They are finding that they can evaluate a professional faster when they have a VisualCV instead of a traditional resume The ultimate goal isto help...
... Paper How Our Money was Ruined The Gold Coin Standard The Gold Bullion Standard The Gold Exchange Standard The Managed Fiat Currency Standard The Stage is Set Is Business to Blame? Are Banks to ... 85 Foreword n this short pamphlet, Congressman Ron Paul has written one of the most enlightening explanations of inflation that I have ever read It is both a history and an analysis That history ... understands that sound economics, moral principles, and individual freedom all go together, like a seamless web They cannot be separated, and they stand or fall together Ron Paul understands that all...
... anticipated at the time Acronyms AAA AARGM ABCCC AESA AFB AFSB AFSOC AGM AIM AMRAAM AOR ASW ATFLIR ATO AWACS BAMS BDA BLU CAOC CAP CAS Antiaircraft Artillery Advanced Anti-Radiation Guided Missile Airborne ... Introduction perpetrated by Osama bin Laden and his al Qaeda terrorist organization, the nation found itself at war against al Qaeda’s main base structure in Afghanistan and against the ruling Taliban ... Information Distribution System Multimission Maritime Aircraft Major Regional Contingency Naval Air Station Noncombatant Evacuation Operation Naval Research Advisory Committee Naval Strike and Air...
... evolve to increased emphasis on relational phenomena such as brand identification, value perception, andthe role of social and relational norms in coproduction and repeat patronage Similarly, ... Consumer Markets: Antecedents and Consequences,” in Handbook of Relationship Marketing, Jagdish Sheth andA Parvatiyar, eds Thousand Oaks, CA: Sage Publications ———, Rajendra S Sisodia, and Arun ... for large-scale mass production and organizational management; andthe services and information economies by the refinement and use of knowledge and skills about information andthe exchange...
... CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA ... AtxBrcb (R) AtxACFc (F) AtxACrcc (R) AmlFd (F) Amlrcd (R) CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA ... V a aspis, V a zinnikeri, andthe remaining four clones having an intron D similar to that of the V am ammodytes ammodytin I1 gene All PLA2 genes contained a TAA stop codon, an AATAAA polyadenylation...
... patrons and early capitalist tycoons What isnewisthe rapid proliferation and specialization of actors onthe art world stage The escalation of market prices has given rise toa cast of characters ... difficult to target and attract audiences, to increase their earnings and other income, to manage their resources and contain their costs, andto identify their mission andthe roles they play in an increasingly ... players and processes in the creation, distribution, and consumption of the visual arts (appreciators and collectors), artists, markets, and nonprofit organizations Defining the Visual Arts As in other...