the jini client constructs a template identifying the desired service and the jlus matches this template against all registered service items and returns the proxy object from the matching service item
Tài liệu THE WEALTH REPORT 2012: A GLOBAL PERSPECTIVE ON PRIME PROPERTY AND WEALTH pptx
... German Chinese Singaporean Canadian Nationalities growing in importance Chinese Indian Brazilian Malaysian Norwegian Kazakhstani UAE Australian Indonesian Turkish Nationalities to watch Egyptian ... to gain cheaper exposure to correlated markets There is, for example, a high correlation between the Australian dollar and Japanese yen exchange rate and equity markets that has made this an alternative ... Zealand 44 Washington DC US 45 Barcelona Spain 46 Paris France 47 Dubai UAE 48 Shanghai China 49 Madrid Spain 50 Singapore Singapore 51 Geneva Switzerland 52 Tuscany Italy 53 Barbados Caribbean...
- 68
- 427
- 0
Tài liệu THE ELEMENTS OF BACTERIOLOGICAL TECHNIQUE A LABORATORY GUIDE FOR MEDICAL, DENTAL, AND TECHNICAL STUDENTS pptx
... bacteriological laboratory, so far as the glass apparatus is concerned, differs but little from that of a chemical laboratory, and the cleanliness of the apparatus is equally important The glassware comprised ... thoroughly and systematically the various bacterioscopical analyses that are daily demanded of the bacteriologist by the hygienist Finally, it is with much pleasure that I acknowledge the valuable assistance ... is invaluable in the preparation of tubular apparatus with sharp curves, and for coating newly-made glass apparatus with a layer of soot to prevent too rapid cooling, and its usually associated...
- 666
- 511
- 0
Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx
... SO2 are associated with the use of coal and other fuels for heating and cooking.52) Biological Pollutants Dander, mold, dust, and other organisms carried into by animals and people are biological ... Simultaneously, a new standard was added to the Japanese Industrial Standard (JIS) that the method of measuring the chemical emission rate from architectural materials should be divided grades.151) ... (in Japanese) Fukutomi, Y., Yasuda, H., Nakazawa, T., Taniguchi, M and Akiyama, K (2009) Indoor Mite and Insect Allergens and Allergic Disease Indoor Environ., 12, 87–96 (in Japanese) World Health...
- 14
- 940
- 1
Tài liệu Báo cáo khoa học: a-Defensins increase lung fibroblast proliferation and collagen synthesis via the b-catenin signaling pathway doc
... The target sequences for the mRNA of b-catenin were 5¢-AAAGCTGATATTGATGGACAG-3¢ The siRNA against luciferase mRNA was used as a control siRNA The target sequence for luciferase mRNA was 5¢-AACG ... without an alteration in the protein contents of total p38 MAP kinase, total Akt, and total GSK3b, suggesting that a- defensin-1 and a- defensin-2 cause the activation of p38 MAP kinase and PI3K ⁄ Akt ... of the p38 MAP kinase and PI3K ⁄ Akt pathways in human monocytes (U937) The mixture of HNP activated only the PI3K ⁄ Akt pathway in human lung epithelial cells (A5 49) [27] Our data indicate that...
- 12
- 602
- 0
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt
... tryptophan catabolism along the kynurenine pathway, and is a medically relevant enzyme in light of the important roles played by QA and PA in physiological and pathological conditions Indeed, QA is ... residues and solvent molecules engaged in ligand recognition and stabilization are drawn as balls -and- sticks and spheres, respectively The major interactions established between the DHAP inhibitor and ... profile and the associated variation in QA and PA levels [7], and other investigations have clearly demonstrated that changes in ACMSD activity are readily reflected by serum and tissue QA levels...
- 9
- 796
- 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... proteinligand bonds when the two domains are taken apart On the other hand, simultaneous interaction of the two fragments domains with the sandwiched ligand had a cooperative character It leads to higher ... (Fig 6) All the above facts mean that the intestinal uptake of analogues can be quite feasible In this regard we plan to examine a group of analogues concerning details of their binding to the specic ... mixture Table Interactions between IF, TC and the ligands CBC, cyano-cobalamin (CNCbl) All reactions were carried out at 20 C and pH 7.5 The results are presented as mean SD Bold type indicates the...
- 12
- 603
- 0
Tài liệu The Design and Performance of a Real-time CORBA Event Service doc
... Facades that actively acquire data from the Sensor Proxies If data was not availHigh Level able to be pulled, the calling I/O Facade would need to block I/O Facade I/O Facade I/O Facade Abstraction ... directed graph where the nodes in the graph are object operations and directed edges indicate that one operation calls another, as shown in Figure 14 CALL-CHAIN LEAF RT Operation CALL-CHAIN LEAF RT ... Subscription and Filtering Module connect and disconnect from the channel The CORBA Event Service defines Event Channels as broadTAO’s RT Event Service model extends the standard casters that forward all...
- 20
- 737
- 0
The Sun to the Earth -- and Beyond: A Decadal Research Strategy in Solar and Space Physics potx
... Aeronautics and Space Administration (NASA), the National Science Foundation (NSF), the National Oceanic and Atmospheric Administration (NOAA), the Office of Naval Research (ONR), and the Air ... basic research and Living With a Star (LWS) for targeted basic research and applications and operations activities in the National Oceanic and Atmospheric Administration (NOAA) and the Department ... between the National Academy of Sciences and the National Aeronautics and Space Administration, National Oceanic and Atmospheric Administration Purchase Order No 40-AA-NR-111308, National Science...
- 197
- 508
- 0
The ‘global health’ education framework: a conceptual guide for monitoring, evaluation and practice doc
... [11,18] as well as Canada [19] and the United States of America [20] have realised the importance of teaching undergraduate medical students about international or global health issues and this teaching ... health and international health teaching in German medical education In doing so, we will assess the state of global health in German medical education and evaluate the applicability of the framework ... health All authors have read and approved the final manuscript Authors’ information KB (Doctoral candidate) studied medicine in Frankfurt (Germany) and Bangalore (India), undergoing a research...
- 12
- 884
- 0
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
... (This data was obtained with the commands InvariantRing, PrimaryInvariants, and SecondaryInvariants in Magma.) One checks that R = R/f1 R is an integral domain Let S be the subring of R generated ... elementary arguments from the geometry of numbers and linear algebra Acknowledgments The authors are grateful for the hospitality of the American Institute of Mathematics, where the first phase of this ... in case K = Q, and by Datskovsky and Wright in general [6]; and for n = 4, and K = Q by Bhargava [3], [2] A weaker version of the conjecture for n = was also recently established by Kable and...
- 20
- 478
- 0
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc
... primarily at the plasma membrane, BAF60b ubiquitination is controlled by Rac and Unkempt BAF60b, as well as BAF6 0a and BAF60c, were found, as expected, entirely localized to the nuclear compartment ... cellular mRNA levels were monitored by RT-PCR (Access RT-PCR system; Promega, Madison, WI, USA) using Unkempt-specific primers 5¢TCTTCGAGTG CAAGTCCAAA and 5¢AAGATCACCTGTGCCTCCAC, and normalized against ... region behaves like an active nuclear localization signal (NLS) [24] Moreover, Rac1, in association with MgcRacGAP, has also been implicated in the nuclear entry of signal transducer and activator...
- 12
- 432
- 0
Next Generation Connectivity: A review of broadband Internet transitions and policy from around the world pdf
... speeds as part of the standard suite of benchmarks seems warranted Japan South Korea France Finland Netherlands Germany Australia Denmark Portugal Iceland New Zealand Norway Sweden Italy United ... European countries, and on the Netherlands and Canada for fixed, positively, and for 3G, negatively, and vice versa for Italy and Spain Table 3.2 provides an at -a- glance report of these various measures, ... Republic Portugal United Kingdom United Austria Germany Finland Denmark Ireland Sweden Netherlands Slovak Slovak Republic Norway Hungary Switzerland Poland Spain Iceland New Zealand Australia Belgium...
- 232
- 669
- 0
A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx
... influence the way in which people can access and make use of their assets Natural capital Natural capital is the quality and quantity of natural resources that are available to people and above all, the ... chain and studying the impact that international legislation has had on them wealth, household asset base: human capital, social capital, natural resources, physical capital and financial capital ... Post-Harvest Fisheries Research Programme PLA Participatory Learning and Action PPA Participatory Poverty Assessment PRA Participatory Rural Appraisal RMA Rapid Market Appraisal RRA Rapid Rural Appraisal...
- 95
- 645
- 0
Báo cáo khoa học: Sherlock Holmes and the proteome ) a detective story Pier Giorgio Righetti1 and Egisto Boschetti2 potx
... each bead has many copies of a single, unique ligand, and each bead has a different ligand from every other bead Considering that, for the synthesis of a protein, many amino acids are used, the ... Moliere, Le Malade Imaginaire, where the candidate physicians would advocate only a single remedy for any possible disease, and hardly a mild one at that (clysterium practicare, postea salassare, infinem ... applied to plasma and sera by Lathrop et al [28] Analysis of cells and tissues Although biological fluids appear to be the ideal substrate for Equalizer Bead treatment, the treatment should also work,...
- 9
- 666
- 0
Báo cáo khoa học: Dissociation/association properties of a dodecameric cyclomaltodextrinase Effects of pH and salt concentration on the oligomeric state pot
... 5Â-AGTACATGTGGGACGTCAC CATGGAGTATGTCCC-3Â (forward) and 5Â-GGGACAT ACTC CATGGTGACGTCCCACATGTACT-3Â (reverse); for the H89V mutant, 5Â-TCTGCTGCAGCA GGGTGTT GAGAAGCGCTGGATG-3Â (forward) and 5Â-CATCCAG CGCTTCTCAACACCCT ... equilibrium analysis, the apparent molar masses of wild-type and mutant CDase were 736 and 491 kDa, respectively (Fig 5A) The data from a series of scans (Fig 5B) showed the common meniscus and the logical ... of change in the peak area shown in Fig 3A was estimated according to an equation of single exponential decay [7], peak areaịt ẳ Aekt ỵ B: From the equation above, the slope of the exponential...
- 13
- 511
- 0
Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf
... were obtained from analysis of the diagonal-peak to crosspeak intensity ratio in the HNHA experiment, with torsion angles calculated from the Karplus equation [34] and assigned a variance of ... Engineering Research Council of Canada, the Alberta Heritage Foundation for Medical Research, CanBiocin Ltd (Edmonton, AB), and the Canada Research Chair in Bioorganic and Medicinal Chemistry References ... backbone w angle restraints were obtained from analysis of dNa/daN ratios [38] The w angle restraint was set to )30° ± 110° for dNa/ daN ratios less than 1, and to 120° ± 100° for dNa/daN ratios...
- 9
- 519
- 0
Parallel Worlds: A Journey Through Creation, Higher Dimensions, and the Future of the Cosmos
... immortal words All the world’s a stage, And all the men and women merely players They have their exits and their entrances During the Middle Ages, the world was indeed a stage, but it was a small, ... a talk about the age of the universe, the previous speaker announced sarcastically, “What you will hear next is all wrong.” And Sandage, hearing of how a rival group had generated a great deal ... apple falls, does the moon also fall? In a brilliant stroke of genius, Newton realized that apples, the moon, and the planets all obeyed the same law of gravitation, that they were all falling...
- 447
- 477
- 0
The Gravity of Weight A CLINICAL GUIDE TO Weight Loss and Maintenance pdf
... general psychiatric and medical standards, and that information concerning drug dosages, schedules, and routes of administration is accurate at the time of publication and consistent with standards ... by the U.S Food and Drug Administration and the general medical community As medical research and practice continue to advance, however, therapeutic standards may change Moreover, specific situations ... brain, and body” and to explain why the control of body weight and its maintenance are “so daunting for so many people.” The problems that they raise and the analyses that they conduct go far...
- 519
- 3,824
- 1
The Sun to the Earth —and Beyond A Decadal Research Strategy in Solar and Space Physics pot
... Aeronautics and Space Administration (NASA), the National Science Foundation (NSF), the National Oceanic and Atmospheric Administration (NOAA), the Office of Naval Research (ONR), and the Air ... basic research and Living With a Star (LWS) for targeted basic research and applications and operations activities in the National Oceanic and Atmospheric Administration (NOAA) and the Department ... between the National Academy of Sciences and the National Aeronautics and Space Administration, National Oceanic and Atmospheric Administration Purchase Order No 40-AA-NR-111308, National Science...
- 197
- 335
- 0
A framework for Enhancing Airlift planning and Excution Capabilities Within the Joint Expeditionary Movement System docx
... to this research; we assume responsibility for any errors Abbreviations ACS AE AECT ALCT AMC AMCT AMD AME ANG AOC AOR APOD APOE ARCENT Agile Combat Support Aeromedical Evacuation Aeromedical ... and execution-specific objectives and tasks and relate these to higher-level military and national security objectives Then, we adapt and apply the closedloop framework to theater airlift planning ... plans are finalized, and therefore the capabilities and status of all potentially relevant airfields must be Tailor Force and Support Packages STT and Closed-Loop Processes Applied to Theater...
- 151
- 453
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25