the basic features of the gimf and its application to a small open oil exporter
Báo cáo khoa học:The principle of flux minimization and its application to estimate stationary fluxes in metabolic networks docx
... synthesis and acetyl-CoA conversion pathway 46 acetyl-CoA fi acetoac-CoA + CoA 47 Acetoac-CoA + NADPH fi 3HB-CoA + NADP 48 3HB-CoA fi PHB + CoA 49 PHB fi 3HB 50 Acetoac + NADH fi 3HB + NAD 51 Acetoac-CoA ... gaining a maximal biomass production at a given total flux is obviously equivalent to maintaining a given rate of biomass production at a minimum of the total flux Insofar, the principle of maximal ... standard conditions For the calculation of stationary and time-dependent states of the reaction scheme in Fig 1, a comprehensive mathematical model was used that takes into account the detailed...
- 18
- 799
- 0
A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 2
... of the center of the cavity to the surface is h The major and minor axis of the cavity are denoted ˆ as a and b respectively a y -axis is pointing perpendicularly out of the image plane 122 The ... slab Slab thicknesses are indicated in the graph Data are calculated based on the EM theory of a 3-layers stratified system Dielectric constants of Au are evaluated using the experimental data ... sides of the layer and the SPP energy density is enhanced because of a lateral compression of the SPP wavelength due to a gradual increase in the phase velocity of the SPP as it approaches the...
- 163
- 449
- 0
A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 1
... colleagues at Laboratory of Optical Imaging and Photodynamic Therapy in the National Cancer Centre, namely Dr Patricia Thong, Ms Ramaswamy Bhuvaneswari, Mr William Chin and Ms Lucky Sasidharan, and ... 12 A schematic sketch of the cavity system considered in this chapter The distance of the center of the cavity to the surface is h The major and minor axis of the cavity are ˆ denoted as a and ... in the folding and stabilization of a protein (42, 43) These bonds are generally weak in the infrared but are Raman-active Other questions answerable by the Raman technique are related to ligand...
- 129
- 265
- 0
Tài liệu Báo cáo khoa học: "Organizing Encyclopedic Knowledge based on the Web and its Application to Question Answering" ppt
... Proceedings of the 33rd Annual Meeting of the Association for Computational Linguistics, pages 189–196 Yuji Matsumoto, Akira Kitauchi, Tatsuo Yamashita, Yoshitaka Hirano, Osamu Imaichi, and Tomoaki Imamura ... Intelligence, pages 662–667 Dan Moldovan and Sanda Harabagiu 2000 The structure and performance of an open- domain question answering system In Proceedings of the 38th Annual Meeting of the Association ... on Research and Development in Information Retrieval, pages 200–207 Makoto Iwayama and Takenobu Tokunaga 1994 A probabilistic model for text categorization: Based on a single random variable with...
- 8
- 508
- 1
Báo cáo khoa học: "Generalized Encoding of Description Spaces and its Application to Typed Feature Structures" potx
... languages typically need to bind variables to various substructures of a TFS, , and then pass those variables outside the substructures of where they can be used to instantiate the value of another ... description languages of binding a variable to a feature value with a scope larger than a single TFS — for example, in sharing structure between a daughter category and a mother category in a phrase structure ... copying, the potential for more compact representations, and other memory management issues such as locality of reference that can only be optimized empirically and relative to a given grammar and...
- 8
- 456
- 0
Báo cáo hóa học: " Research Article On a Class of Parametric Transforms and Its Application to Image Compression" ppt
... Hadamard-like and Haar-like transforms, which are of a particular interest since they are generalizations of the classical Hadamard and Haar transforms Definition Within the class Ω consider the family Ω of ... Figure 12 allows also automatic generation of transform parameters meaning that the transform may automatically be adapted to the input signal or image CONCLUSION A new class of parametric transforms ... 2: The fast Hadamard-like transform of order N = 11 Figure 3: The fast Haar-like transform of order N = 11 The classical Hadamard transform belongs to the family Ω of Hadamard-like transforms and...
- 14
- 484
- 0
Modeling and characterization of HBT transistor and its application to EBG multiband antenna
... regions of operations Measured and simulated S-parameters for GaAs HBT Measured and simulated S-parameters for GaAs HBT Measured and simulated S-parameters for GaAs HBT Photograph of fabricated ... simulation results and the measurement data obtained Taking the inherent advantage of the coplanar waveguide, the planar slot antenna fed by coplanar waveguide is selected for the integration of an ... power at 2.45 GHz Photograph of fabricated active slot antenna with PBG feed E-plane of multi-band active antenna at 1.9 GHz H-plane of multi-band active antenna at 1.9 GHz E-plane of multi-band active...
- 253
- 360
- 0
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge
... (5'!3') AGAGTTTGATCCTGGCTCAG GGCTACCTTGTTACGACTT CTGGAGTTTGGCAGAGGG GTTAGCTACGGCACTAAAAGG CCGTCATCTACWCAGGGTATTAAC CCCTCTGCCAAACTCCAG GTTAGCTACGGCACTAAAAGG GCTGCCTCCCGTAGGAGT GCAGCCACCCGTAGGTGT ... Quantification using Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the laboratory-scale and the full-scale activated sludge were quantified ... DNA extracted from activated sludge were evaluated In addition, the amount of Candidatus ‘Accumulibacter phosphatis’ in laboratory-scale EBPR and full-scale activated sludge samples were quantified...
- 7
- 719
- 0
Stress and Performance - A Review of the Literature and Its Applicability to the Military pdf
... review to ensure that they meet high standards for research quality and objectivity Stress and Performance A Review of the Literature and Its Applicability to the Military Jennifer Kavanagh Approved ... that battle fatigue and other stress reactions may account for as many as 50 percent of the casualties in a given war As a result of the effect that stress can have on service members and their ... X and Y (and X and Y are correlated), then X will be correlated with A and will have an effect on Y independent of X A moderator variable is one that affects (usually reduces) the causal relationship...
- 86
- 607
- 0
báo cáo hóa học:" Research Article Pitch- and Formant-Based Order Adaptation of the Fractional Fourier Transform and Its Application to Speech Recognition" pptx
... chirped autocorrelations and the fractional Fourier transform are used to estimate the features which can characterize a measured marine-mammal vocalization In [21], sinewave analysis and synthesis ... 1273–1276, Niagara Falls, Canada, May 2004 [20] P L Ainsleigh and N Kehtarnavaz, “Characterization of transient wandering tones by dynamic modeling of fractionalFourier features, ” in Proceedings of IEEE ... shown that FrFTMFCC features can greatly increase the discrimination of tones compared to FFT-based MFCC features and that the discrimination of Mandarin vowels and English intervocalic consonants...
- 14
- 384
- 0
Báo cáo hóa học: " Research Article The Generalized Gronwall Inequality and Its Application to Periodic Solutions of Integrodifferential Impulsive Periodic System on Banach Space" potx
... Solutions and Applications, vol 66 of Pitman Monographs and Surveys in Pure and Applied Mathematics, Longman Scientific & Technical, Harlow, UK, 1993 V Lakshmikantham, D D Bainov, and P S Simeonov, Theory ... integrodifferential equations in Banach spaces,” Journal of Mathematical Analysis and Applications, vol 177, no 2, pp 538–552, 1993 12 J H Liu, “Bounded and periodic solutions of differential equations in Banach ... that the set K can be approximated to an arbitrary degree of accuracy by a precompact set Kε Hence K itself is a precompact set in X That is, P takes a bounded set into a precompact set in X As...
- 22
- 296
- 0
Báo cáo y học: "Estimation of stature from the foot and its segments in a sub-adult female population of North India" pps
... Principals 14 of Government Schools located in villages Nanakpur, Marranwala and Bassolan of Tehsil Kalka, District Panchkula in Haryana state of North India for allowing data collection Thanks are ... Bassolan The participants were taken from a mixed population of the area i.e belonging to caste groups Lobana, Saini, Gujjar, Kumhar, Teli, Nai, Dhiman and Lohar These are the major caste groups of ... India, strictly marrying within their own caste The majority of the individuals from these caste groups are engaged in agriculture, and animal husbandry Data collection and anthropometry The data...
- 33
- 480
- 0
báo cáo khoa học: " A linkage map for the B-genome of Arachis (Fabaceae) and its synteny to the A-genome" doc
... LG of the AA map, B6 with A6 and A1 0, and B7 with A7 and A8 Synteny analysis A total of 51 common markers mapped in the AA and BB genome diploid maps spanned the 10 linkage groups of both maps ... development and analysis, and participated in drafting the manuscript Additional material Additional File Data of crossings between A ipaënsis (accession K30076) and A magna (K30097) The data provides the ... to 600 bp The selected fragments were purified from the agarose gels using phenol/chloroform, and ligated into Sau3AI specific adaptors (5'-cagcctagagccgaattcacc-3' and 5'-gatcggtgaaatcggctcaggctg-3')...
- 10
- 399
- 0
Báo cáo khoa học: "Stable replication of the EBNA1/OriP-mediated baculovirus vector and its application to anti-HCV gene therapy" pot
... Miyamura T, Ohbayashi A, Harada H, Katayama T, Kikuchi S, Watanabe Y, Koi S, Onji M, Ohtaet Y: Hepatitis C virus infection is associated with the development of hepatocellular carcinoma Proc Natl ... 5:2533-2542 Hirai H, Satoh E, Osawa M, Inaba T, Shimazaki C, Kinoshita S, Nakagawa M, Mazda O, Imanishi J: Use of EBV-based vector/HVJ-liposome complex vector for targeted gene therapy of EBV associated ... TBE urea gel after 3, 7, and 14 days gated anti-goat antibody (Sigma Chemical Co., St Louis, MO) was used as the secondary antibody RNA purification and real-time RT-PCR Total RNA was isolated...
- 8
- 328
- 0
Báo cáo y học: "Dynamic simulation of red blood cell metabolism and its application to the analysis of a pathological condition" docx
... oxidantinduced decrease of hexokinase and pyruvate kinase, and the maximum activity of these enzymes was allowed to change according to the ratio of GSH and GSSG The equations and parameters used are derived ... simulation for analyzing the pathology of human diseases should not approximate the "mathematical steady state" Moreover, in the case where the system reaches a steady state with a certain oscillation, ... solve the problems associated with developing a model that simulates all the cellular metabolic pathways The mathematical steady state may not be the normal state of real cells During this simulation...
- 11
- 386
- 0
Báo cáo sinh học: "The use of retroviral vectors for gene therapy-what are the risks? A review of retroviral pathogenesis and its relevance to retroviral vector-mediated gene delivery" pptx
... RNA that contains the retroviral packaging signal (ψ) and so made amenable to molecular manipulation The genetic structure of the virus is such that the viral cis (sequences that are biologically ... means that this has already happened The Tat dependence of the HIV-1 LTR may also provide an extra measure of safety as long as Tat is not transferred along with the vector However, the enhancing ... of mammary epithelial cells, the eventual site of tumour formation Although Sag is a major determinant of the oncogenic potential of MMTV it should be noted that in the final analysis malignancy...
- 13
- 498
- 0
Molecular mechanisms underlying the pathogenesis of nasal polyposis and its response to steroid treatment
... of nasal polyps Picture was taken from the patient with NP under endoscope examination The characteristic features of nasal polyps are large quantities of extracellular edema and an inflammatory ... cranial cavity The inferior wall is the palate which separates the nasal cavity from the oral cavity The superior, middle, and inferior turbinates (also called concha) form the lateral wall as ... GRs and the proinflammatory transcription factors, such as NF kappa B and AP-1 [Hayashi et al., 2004] For example, NF kappa B recruits transcriptional coactivators, such as CBP or p300/CBP associated...
- 293
- 379
- 0
Functional study of zebrafish udu and its relationship to the notch signaling pathway
... p53-dependent apoptosis requires activation of the ATM-Chk2 pathway The DNA damage response pathway is a cellular surveillance system that senses the presence of damaged DNA and elicits an appropriate ... human BAF155/170, Drosophila ISWI), as well as, histone acetyltransferase (HAT) (yeast and human Ada2p) and deacetylase (HDAC) (co-REST, Mta-L2 and N-CoR) (Aasland et al., 1996; Humphrey et al., ... Nuclear co-activators such as Mastermind/SEL-8/LAG-3 (MAM), histone acetyltransferase (HAT) and p300/CBP-associated factor, form a transcriptional activated complex and activates the expression of...
- 212
- 337
- 0
TEACHING FOR EXPERIENTIAL LEARNING AND ITS APPLICATION TO THE VOCATIONAL TRAINING OF CIVIL ELECTRICAL SERVICES FOR RURAL LABORERS
... previous generation With low living standards, lack of jobs, the expansion of industrial areas as agricultural land area is shrunk, leading to the increase of waves of migration to urban areas looking ... Electrical installations for small manufacturing facility; Interior electrical network installation; Repair of fans, motors and voltage regulator; Repair and maintenance of refrigerators and air ... learners are eager and are attracted and actively participate in learning activities; there are many opinions and arguments, among members of the group, among the groups together to address the learning...
- 28
- 278
- 0
ON THE PETERSON HIT PROBLEM OF FIVE VARIABLES AND ITS APPLICATIONS TO THE FIFTH SINGER TRANSFER
... Chơn and L M Hà, Lambda algebra and the Singer transfer, C R Math Acad Sci Paris 349 (2011), 21-23, MR2755689 [4] P H Chơn and L M Hà, On May spectral sequence and the algebraic transfer, Manuscripta ... ON THE PETERSON HIT PROBLEM OF FIVE VARIABLES Proof Let x be an admissible monomial of degree 15 in P5 and ω(x) = (3, 4, 1) From the proof of Lemma 3.5, x is a permutation of one of the monomials ... Manuscripta Math 138 (2012), 141-160, MR2898751 [5] M C Crabb and J R Hubbuck, Representations of the homology of BV and the Steenrod algebra II, Algebraic Topology: new trend in localization and periodicity,...
- 13
- 474
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25