the account shall be credited with a debit to any of the available reserve accounts or to account 129
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt
... reduce cortical inhibition are therefore appealing for augmenting motor learning in behavioral therapies [38-40] Here we present data supporting the idea that depending on the nature of the training ... promote restoration of movement control A limitation of the present study design was the lack of power to conduct a multi-factorial analysis that includes all the data (i.e., agonist and antagonist ... relating to agonist-antagonist muscle pairs A single suprathreshold pulse of Transcranial Magnetic Stimulation (TMS) over the hand area of M1 results in a balance of inhibitory and excitatory processes...
- 8
- 432
- 0
Báo cáo toán học: "The Fraction of Subspaces of GF(q)n with a Specified Number of Minimal Weight Vectors is Asymptotically Poisson" pot
... finite, there are many counting problems associated with fundamental concepts of linear algebra; for example, how many subspaces of dimension k are there in the vector space GF(q)n ? The answer is often ... restricting the covering relation of P to two adjacent ranks be regular in the graph theoretic sense.) For example, both the subsets of a set and the subspaces of a vector space, ordered by inclusion, are ... versions of λ tends to and also that the theorems for either version of λ imply the theorems for the other version Since the the electronic journal of combinatorics (1997), #R3 ratio of the two...
- 8
- 421
- 0
Designing a supplementary reading syllabus with a view to improving reading skills for the first-year English majors at Hai Phong Private University
... motivate learners‟ study more than other skills because it is much easier and can be done at any time, anywhere with a lot of available materials The main purpose of any reading program is to enable ... Definition of syllabus Syllabus is a common and familiar notion in language teaching and learning Many of the teachers regard syllabus as a standard material orienting them what should be taught to their ... to be able to use it in an appropriate way 1.1.3 Types of syllabus Over the past few years, a great deal of attention has been paid to the types of syllabuses In fact, there exist many approaches...
- 83
- 992
- 1
Tài liệu Updating a DataSet with a Many-to-Many Relationship ppt
... containing a parent, child, and many -to- many junction table, as well as the DataRelation objects between them A DataAdapter object is created for each table and the stored procedures to select, ... insert, and update records in the data source are specified for each The LoadData( ) method is called to retrieve data for each table in the DataSet Finally, the default view for the parent and the ... DataSet back to the data source by calling in the correct order the Update( ) method of the DataAdapter object for subsets of the data in each of the parent, child, and junction tables Create...
- 19
- 304
- 0
Báo cáo khoa học: "Hedge classification in biomedical texts with a weakly supervised selection of keywords" doc
... potentially relevant features (we managed to discard 89.5% of all the initial candidates automatically) made it easier for us to manually validate the remaining keywords This allowed us to incorporate ... used and happens with many other irrelevant terms (not just stopwords) The automatic elimination of these irrelevant candidates is one of our main goals (to limit the number of candidates for manual ... re-evaluated all 362 candidates together and filtered out all phrases that had a shorter and thus more frequent substring of themselves among the features, with a similar class-conditional probability...
- 9
- 407
- 0
báo cáo hóa học: " Too much or too little step width variability is associated with a fall history in older persons who walk at or near normal gait speed" pdf
... number of falls in the past year Data Analysis Prior to data analyses the gait variability data were examined for normality The gait variability data were relatively normally distributed (mean values ... gait data collection, analyzed the data, and drafted the manuscript JEB participated in the data analyses and manuscript preparation JVS participated in the design of the study, data analyses, and ... that we examined the association of gait variability to falls over the past year where others have look at the association with future falls [2,3] In actuality, the participants' gait was measured...
- 8
- 402
- 0
Báo cáo hóa học: " Research Article On a Hilbert-Type Operator with a Symmetric Homogeneous Kernel of −1-Order and Applications" doc
... Bulletin of the Belgian Mathematical Society, vol 13, no 4, pp 577–584, 2006 [3] B Yang, “On the norm of an integral operator and applications,” Journal of Mathematical Analysis and Applications, ... applications,” Journal of Mathematical Analysis and Applications, vol 325, no 1, pp 529–541, 2007 [2] B Yang, “On the norm of a self-adjoint operator and applications to the Hilbert’s type inequalities,” ... Yang, “On the norm of a self-adjoint operator and a new bilinear integral inequality,” Acta Mathematica Sinica, vol 23, no 7, pp 1311–1316, 2007 ´ e [5] A B´ nyi and C Oh, “Best constants for...
- 9
- 334
- 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
... used to develop an ELISA system based on the general protocol of the Varelisa® tests (Pharmacia Diagnostics) Assay performance characteristics To evaluate the performance of the assay, the precision, ... peptide-based assay (99.8%; data not shown) Further studies are in progress to compare the assay performance of the anti-SMP assay with that of other commercially available anti-Sm immunoassays For ... (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating characteristic analysis The intra-assay and interassay variability, expressed as coefficient of variation...
- 11
- 593
- 0
Báo cáo khoa học: "Palliative radiotherapy in patients with a symptomatic pelvic mass of metastatic colorectal cancer" pot
... for dysphagia in advanced esophageal cancer [27-30] A phase I/II trial from Canada [29] prospectively treated 22 patients with dysphagia from advanced incurable esophageal cancer with palliative ... Martenson JA: Irradiation of adenocarcinomas of the gastrointestinal tract Front RadiatTherOncol 1988, 22:127-148 Williams IG: Radiotherapy of carcinoma of the rectum In Dukes C, ed Cancer of ... symptom control rate, it might be better to treat with a higher RT dose to increase the palliation rate and symptom control duration In the pelvic cavity, the tolerance dose of normal tissue is a...
- 8
- 457
- 0
Báo cáo y học: "Synovial fluid level of aggrecan ARGS fragments is a more sensitive marker of joint disease than glycosaminoglycan or aggrecan levels: a cross-sectional study" pps
... used as an ARGS standard in the aggrecan ARGS ELISA Aggrecan ARGS ELISA Quantification in SF of aggrecan fragments with the N-terminal 393ARGS was by a sandwich ELISA using an anti-KS antibody as ... Statistical analysis For some patients the available volume of SF was not large enough to perform all assays, which explains the variation in numbers between assays Of the 295 subjects, 113 had ARGS fragment ... confirms that aggrecanase cleavage in the IGD is a major contributor to aggrecan degradation in human joint pathology, and extends our understanding of the relative contribution of aggrecanase activity...
- 11
- 339
- 0
Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx
... DDAHII-449 Primer Allele GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGG Allele GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGC Common CCAGCTTTCTCCTTCTGTCCCATAA Table Demographics and asymmetrical dimethyl arginine ... cardiovascular failure, a non-cardiac organ failure score was obtained by excluding the cardiovascular component from the total SOFA score There was a positive correlation between this score and ... count was not correlated with ADMA at either time point (Table 6) Correlation between severity of organ failure and ADMA and IL-6 levels Multivariate analysis of the relationship between the SOFA...
- 7
- 265
- 0
Báo cáo y học: "The Nordic back pain subpopulation program: Can low back pain patterns be predicted from the first consultation with a chiropractor" ppt
... Prior to data collection, the participating chiropractors had been informed of the purpose of the study and the rationale for the diagnostic classification system by the first author At a one-day ... (Table 3) There was not a significant correlation between age and the total number of days with LBP Gender A larger part of the female patients (31%) had a pain course pattern with unchanged pain ... chiropractor patients [15], but maybe surprising to many clinicians, the duration of the present LBP episode was not associated to any of the outcome measures Because of the small numbers within each...
- 8
- 293
- 0
Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot
... were in agreement with reported data that capped dsRNA was active and stable [28] The RNAi effects that we achieved more than doubled the effects of antisense that was normally around 30% of down ... Stratford IJ, et al.: ZD1839 ('Iressa'), a specific oral epidermal growth factor receptor-tyrosine kinase inhibitor, potentiates radiotherapy in a human colorectal cancer xenegraft model Br J Cancer ... increasing concentration of cisplatin ranged from to 50 ng/ml for another 24 h MTT of 20 µl (1 mg/ ml) was added to each well for h at 37°C to allow MTT to form formazan crystals by reacting with...
- 12
- 314
- 0
LET''''S LEARN ENGLISH WITH A SMILE - HOW TO TELL THE SEX OF A BIRD - PHÂN BIỆT CHIM TRỐNG CHIM MÁI - MẶT TRỜI BÉ CON - TRẦN TIẾN
... HOW TO TELL THE SEX OF A BIRD THIS IS AMAZING !!! Until now I never fully understood how to tell the difference between Male and Female birds I always thought it had to be determined surgically ... Until now Below are two birds Study them closely See if you can spot which of the two is the Female It can be done Even by one with limited bird watching skills…! Send this to all of the men you ... watching skills…! Send this to all of the men you know, who could with a good laugh, and to all women who have a great sense of humor !!! Collection by FGMLGMU 06/03/2011 ...
- 4
- 465
- 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... set according to the manufacturer’s protocol Sequencing analysis Two oligonucleotides (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299 ) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ ... EH Acknowledgments We would like to thank Dr Y Watanabe and Dr Y Izumi for collecting the samples, and Ms H Tobe, M Nakamura, and K Sugama for their technical assistance This work was supported ... studies to map disease loci in families and in forensic applications Recent reports indicate that some VNTR sequences may function as transcriptional or translational regulators, and that they may...
- 7
- 612
- 1
The 25 most difficult questions you'll be asked on a job interviewThe 25 most difficult questions you'll be asked on a job interview
... like to be a part of that team If the company places a great deal of emphasis on research and development, emphasize the fact that you want to create new things and that you know this is a place ... terms of skills initiative, and the adaptability to be able to work comfortably and effectively with others Mention that you like to hire people who appear capable of moving up in the organization ... us? Say that you are interested in a career with the organization, but admit that you would have to continue to feel challenged to remain with any organization Think in terms of, "As long as we...
- 11
- 511
- 2
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
... Instead, the major mechanism of GAG enhancement appears to be allosteric and uses conformational activation of the serpin Heparin cofactor II possesses a unique amino-terminal extension that contains ... bottom of the inhibitor [6] In the process, the structure of the protease appears to be deformed by being ‘crushed’ against the bottom of the inhibitor [7] In particular, this deformation of the ... years, the physiological activator of HC-II has been assumed to be extravascular dermatan sulfate [56–64], which would complement the intravascular effect of heparan sulfate binding to AT Maimone and...
- 10
- 668
- 0
The World with a Thousand Moons pdf
... up to the fact that he had made a bad slip He hastily covered up "You have to be a good bit of a space-sailor to be a meteorminer, Miss Loring You have to cover a lot of territory." He was thankful ... once toward Mars, captain," Gloria was saying quietly to the stunned officer Her face was still very pale Kenniston, standing tense, had had an idea A desperate chance to make a break, in the face ... escort of armed pirates guarding them, and Dark and Holk Or ahead, they started through the jungle toward the pirate camp 38 Chapter Asteroid Horror T he pirate encampment was a big clearing hacked...
- 52
- 408
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25