the a and assertions
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
... synthesis was from Rapp Polymere (Tubingen, Germany), and all ¨ other chemicals were from Merck (Darmstadt, Germany) Synthesis of the individual a- and b- domains The individual a- and b-domains ... kPa For the a- domain, an average molecular mass of 3021.3 Da (3021.7 Da, theoretical) was observed, calculated from the detected [M + 5H]5+ and [M + 4H]4+ quasi molecular ions at m ⁄ z 605.2 and ... form a distorted chair The C-terminal a- domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and human are available...
- 14
- 485
- 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
... Correlations between the values of the association rate constant of BR (k¢) and the quantum yield of BR (c) The data for the a and b subunits within liganded tetrameric HbA are shown in (A) and ... both the a and b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association and dissociation rate constants for the b subunits are found to exceed 2.2 ± 0.3- and ... tÞ þ ab ÁexpðÀkb Á ½O2 ÁtÞ ð2Þ where DAnorm is a normalized change in optical density of the sample and aa, ab, k a and k¢b are the amplitudes and rate constants of BR The quantity [O2] is the...
- 11
- 577
- 0
The a and b adapters are used as priming sites for both amplification
... ligase • The strands are denatured using sodium hydroxide to release the ssDNA template library (sstDNA) The Adapters • The A and B adapters are used as priming sites for both amplification and sequencing ... Preparation of the DNA • DNA is fragmented by nebulization • The DNA strand’s ends are made blunt with appropriate enzymes • A and “B” adapters are ligated to the blunt ends using DNA ligase ... filters all DNA rich beads from empty beads, and then extracts the biotin beads from the DNA rich beads • The DNA in the beads are denatured again using sodium hydroxide, creating ssDNA rich beads...
- 19
- 390
- 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... treatment; data not shown) After h, many of these cells displayed an apparent arrest of DNA and vacuolar segregation between the mother and daughter (Fig 6D; middle image) By 24 h, over half had ... the Hsp9 0a ORF using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse primer CTTC ATCTGCAGTTAGTCTACTTCTTCCAT (PstI site underlined;...
- 11
- 427
- 0
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx
... transferase Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase IGb3 synthetase IGb3 synthetase Forssman synthetasea Forssman synthetase Human Rat Pig Mouse Human ... the urinary bladder, the uterus and the thymus A weaker signal was obtained from the pancreas and very weak, barely detectable, signals were visible from a salivary gland, muscle and spleen The ... room temperature Amplification of the cDNA corresponding to the A enzyme cDNA was performed with the following primers: CAGACGGATGTCCAGAAAGTTG and: GCTACAG GTACCGCCTCTCCAA Amplification was performed...
- 8
- 499
- 0
The Design and Implementation of a Log-Structured File System
... purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database ... the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is reserved ... rapidly, but the improvements have been primarily in the areas of cost and capacity rather than performance There are two components of disk performance: transfer bandwidth and access time Although...
- 15
- 1,434
- 0
Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"
... write the manuscript Dana Lawrence performed thematic analysis and coding of transcripts and prepared components of the manuscript Robert Rowell also performed thematic analysis and coding of transcripts ... medical participants both noted lack of formal clinical studies examining effectiveness of manual/manipulative approaches to manage (diagnose and treat) musculoskeletal chest pain, and lack of ... preclinical and clinical trial work along this line of inquiry Education and educational research What becomes obvious is that a lack of research has impact and implications for the education of...
- 10
- 788
- 0
Natural botanical products have a long history in the world and are featured in using a complex
... 28 days Tumor areas were measured every days using a caliper, and the tumor area was calculated according to the formula: tumor volume (mm3) = d2 x D/2, where d and D were the shortest and the ... hormone-responsive and hormone-refractory prostate carcinoma cells: mechanistic studies Int J Oncol 2002, 20:681-9 Yasukawa K, Ikeya Y, Mitsuhashi H, Iwasaki M, Aburada M, Nakagawa S, Takeuchi M, Takido M ... intratumoral injection of "Star-99" in treatment of hepatocellular carcinoma of nude mice World J Gastroenterol 2003, 9: 701-5 Nandakumar KS, Lakshmi Rao K, Pardhasaradhi BV, Khar A Upregulation of antitumor...
- 9
- 712
- 0
The sociology and psychology of terrorism who become a terrorist anh why
... individual biographical accounts, as well as sweeping sociopolitical or psychiatric generalizations A lack of data and an apparent ambivalence among many academic researchers about the academic value ... bin Laden need a logical reason, for he believes that he has a mandate from Allah to punish the “Great Satan.” Instead of thinking logically, Asahara thinks in terms of a megalomaniac with an apocalyptic ... political, and social factors that have always motivated radical activists, as well as the possibility that biological or physiological variables may play a role in bringing an individual to the...
- 186
- 448
- 3
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works
... the differences in the behaviors and attitudes of the grandmother, the father and the mother and the children at least cause discontent to one another The grandmother held the floor most of the ... mother had done was apparently a revenge against her and her husband for they had not been able to save their four and a half month baby from infant death For the past few years, Mabel had always ... races such as white, black or African-American, American Indian or Alaska native, Asian, native Hawaiian, other Pacific Islander and ethnic groups due to immigrations from all around the world...
- 49
- 785
- 1
A study on cultural obstacles to the teaching and learning of speaking skills in the classroom of grade 10 at nguyen tat thanh high school
... However, in the thesis, the researcher wants to find out the attitudes, as well as the cultural awareness in teaching and learning spoken English of the teachers and the students of 10 th grade at NTT ... theoretical background related to culture, language and speaking skills * Chapter provides an analysis on the attitudes of the teachers and students at -3- NTT towards the position of culture and speaking ... important role in teaching and learning language.” (Eli Hinkel, 1999) In fact, language is part of a culture; language is deeply embedded in a culture; language and culture cannot be separated, and...
- 38
- 1,225
- 0
the meaning and structure of a narrative a systemic functional analysis
... for the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... producing a correct and effective clause and utterance Third, based on these fundamental theories in analyzing a text teachers of English can further analyze the mistakes that learners easily make ... writer playing the role as recounter - Kumiko Tsuchida, the railway guard, the police, and the Japanese embassy Mode: Mood: declarative Modality: ability of the main character on the past - Medium...
- 39
- 826
- 2
A fairy story - The Lizard and the Damsel
... daughter and said PEASANT – DAUGHTER Then the peasant called his second daughter and said PEASANT – DAUGHTER Then the peasant called his youngest daughter and said PEASANT – DAUGHTER – PEASANT The ... PEASANT ‘I will never marry a lizard Sorry, father.’ NARRATOR PEASANT – DAUGHTER NARRATOR PEASANT – DAUGHTER – PEASANT NARRATOR PEASANT – LIZARD NARRATOR DAUGHTER – LIZARD NARRATOR DAUGHTER NARRATOR ... never agree to marry a lizard.’ NARRATOR PEASANT – DAUGHTER – PEASANT NARRATOR PEASANT – LIZARD NARRATOR DAUGHTER – LIZARD NARRATOR DAUGHTER NARRATOR LIZARD NARRATOR 46 Text © Sagrario Salaberri...
- 16
- 819
- 2
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
... Priorities and hazards for Economies Variable levels of activity and management capability Ships’ ballast water and hull fouling are the most important vectors International shipping, aquaculture ... Framework Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Management capabilities and approaches APEC and the MRCWG have a ... Framework - Introd uced Marine Pests Phase – Consultancy Identified current management capabilities and approaches Priorities and hazards for APEC Economies Considerations for a Risk Management...
- 10
- 583
- 0
Tài liệu The Insider’s Guide to PR: Chapter 4 A PR LIFE – THE LADDER, THE PAY AND THE LIFESTYLE doc
... operate a press office which acts as an interface between the brand and the media Getting results is always satisfying Setting up a photocall and then seeing it in the papers the next day is a ... and there are plenty of opportunities to go forth and network through initiatives like PRCA FrontLine Katherine Smith Campaign Manager Firefly Communications Geography graduate The most rewarding ... childcare Assistance with domestic costs 3% 1% Source: Frontline Survey 2001 While it may not be all champagne and caviar as the media would like to portray, the quality of life is good, salaries are...
- 2
- 641
- 1
A comparison on cohesive devices between the gift of the magi and its two vietnamese translation versions
... was a physician When William was three, his mother died, and he was raised by his parental grandmother and paternal aunt William was an avid reader, but the age of fifteen he left school and then ... Vietnamese readers Apart from The Last Leaf, the readers have known The Gift of the Magi as a typical short- story by O Henry It is translated into Vietnamese by many translators and each Vietnamese ... distinguishable meanings:1) translating, the process (to translate, activity rather than the tangible object); 2) a translation: the product of the process of translating (e.g: the translated text) and...
- 61
- 1,013
- 2
Tài liệu Global Warming A Mind Mapper''''s Guide to The Science and Solutions pdf
... natural as well as manmade part of the - Scientist at NASA, Dr James Hansen earth’s atmosphere which have the ability to trap and retain heat) in the atmosphere and re-emitted back to the earth ... experience a dramatic shift in the way they think and feel about the environment, Learn about the practical things you can to make a difference in the world; and Take the actions you can take similar ... broadcast appearances, interviews and U.S Supreme Court ruled that CO2 and other heat newspaper advertisements The campaign’s trapping emissions are air pollutants under the Clean newspaper advertisements...
- 103
- 743
- 4
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor
... self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb , and arc the rotor fluxes induced in the stator phases are The ... same advantages as the Park transformation A Mathematical Model of the BDCM We suppose that the motor has the following typical features : - The airgap length is constant and large since the magnets ... magnets are surface mounted and have the same permeability as air As a result, the armature reaction is negligible The magnetic circuit has an important air part so that the effects of the saturation...
- 8
- 517
- 1
Tài liệu COMMUNICATION FROM THE COMMISSION TO THE COUNCIL AND THE EUROPEAN PARLIAMENT Innovation in a knowledge-driven economy ppt
... be appreciated The media are important as a source of information on progress in research and innovation: they also draw attention to the balance of advantage and disadvantage We need to make ... implemented by all Member States in a harmonised way and has become the innovation statistics instrument of the Community and a model for non-Member States such as Canada and Australia At present, the survey ... evaluation and peer review of regional and national programmes for enhancing innovation and of the bodies which implement them 2001 At the Union level, the Commission should act as a catalyst and...
- 32
- 502
- 0
Tài liệu The Economic and Social Effects of Financial Liberalization: A Primer for Developing Countries pptx
... tích cực vay nợ (kết nghịch) => rủi ro tín dụng cao => người cho vay phản ứng nghịch khơng cho vay, kể người có rủi ro thấp thấp Rủi ro đạo đức (Moral Hazard): Xảy sau giao dịch Người vay có động ... quản lý Slide #14-6 Các quan điểm l a chọn cấu trúc tài Một công ty tài trợ cho dự án mơi theo cac cach: cách: 1.Vay nợ 2.Huy Huy động cổ phần tư tài trơ co phan va tự tai trợ Tài trợ cổ phần từ ... ò ) – Trong đo: đó: EBIT (Earnings before interest and taxes) T : Ta es Taxes EBIT x (1- T)= Lợi nhuận sau thuế nợ vàø vốán cổå phầàn h ka : Chi phí vốn trung bình theo trọng số Nếu EBIT số giá...
- 31
- 463
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25