that the knowledge of the true god is necessary for a magician and what the old magicians and philosophers have thought concerning god
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
... Taq (Takara, Japan) in a total volume of 50 lL containing 55 pg of competitor At this concentration, the band intensity of the amplified product from the competitor was same as that of the product ... proposed that the WD protein acts as a copperspecific pump that mediates the export of copper from the cytosol, similar to the P-type ATPase [14] On the basis of the fact that MREs mediate the transcriptional ... Several studies have reported that MREa in the promoter of the MT gene possesses transcriptional regulatory activity and that a variety of nuclear transcription factors interact specifically with...
- 11
- 628
- 0
Tài liệu Báo cáo khoa học: Myristoylation of the dual-specificity phosphatase c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis pdf
... acts as a positive mediator of the ErbB2-induced signaling pathways that trigger mammary tumorigenesis and metastasis [12,13], and the tyrosine phosphatase SHP-2 is necessary for activation of ... modulates the specificity and efficiency of signal transduction [30] N-myristoylation is the covalent attachment of myristate, a 14-carbon saturated fatty acid, to the N-terminal Gly of eukaryotic and ... phosphatases have long been viewed as negative regulators that terminate MAPK signaling, it is now evident that they play an important role in determining the magnitude and duration of MAPK activation,...
- 11
- 580
- 0
Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx
... as described in Materials and methods Enzyme activity was analysed by the standard assay and the immunoreactivity was detected by Western blot analysis and quantitated as described in Materials ... Fig Alignment of the amino acid sequences between the catalytic Asp44 and His264 residues from human, murine and rat TPP II A dot indicates that the amino acid is identical to that in the human ... indicated by asterisks to activate the material, as previously described [15] However, all attempts so far to associate this material have failed Thus, it appears that the isolated Arg252-containing...
- 6
- 520
- 0
Báo cáo khoa học: The N-terminal hybrid binding domain of RNase HI from Thermotoga maritima is important for substrate binding and Mg2+-dependent activity pot
... (5¢-cggagaugacgg-3¢), 29 base DNA13-RNA4(5¢-AATAGAGAAAAAGaaaaAAGATGGCAA DNA12 AG-3¢), 29 base DNA15-RNA1-DNA13 (5¢-AATAGAGAA AAAGAAaAAAGATGGCAAAG-3¢) and 3¢-FAM-labeled 18 base RNA9-DNA9 (5¢-uugcaugccTGCAGGTCG-3¢) ... TGGGTTTGAGAGCATATGAAGTTGG CAAAAAAATACTAC-3¢ for primer 1, 5¢- CGCATATG GAGACGATGATCGCCTACGTCGATG-3¢ for primer 2, 5¢-ACCGTTAAGCTTTCATAAACATCCTCCTTT-3¢ for primer 3, and 5¢- CGGAATTCTCATGTGTCCAGTTCTG GACAGATGCACTC-3¢ ... (truncated) ) Tm (intact) DHm and DSm are the enthalpy and entropy changes of unfolding at Tm calculated by van’t Hoff analysis contrast, the KD value of Tma-CD was considerably higher than that of...
- 16
- 459
- 0
Báo cáo khoa học: A novel factor XI missense mutation (Val371Ile) in the activation loop is responsible for a case of mild type II factor XI deficiency doc
... following supplementary material is available online: Fig S1 Comparison of the catalytic properties of recombinant and plasma-derived FXIa This material is available as part of the online article from ... aliquot of the activation solution was taken to measure the Michaelis parameters of S-2366 hydrolysis by FXIa The Michaelis parameters, kcat and Km, were calculated on the basis of known concentration ... plasma as substrate (Hemoliance, Salt Lake City, UT) FXI antigen was measured by an ELISA based on a goat anti-human FXI afnity puried IgG as capture antibody and a goat antihuman FXI peroxidase-conjugated...
- 11
- 563
- 0
Báo cáo khoa học: The activity of Plasmodium falciparum arginase is mediated by a novel inter-monomer salt-bridge between Glu295–Arg404 doc
... in the bacterial and mammalian templates P falciparum Glu295 aligns with an Asp in mammals (human arginase II: Asp223; rat arginase I: Asp204), fungi and bacteria (B caldovelox arginase: Asp199) ... In mammals, two isoforms of arginase have been identified: arginase I is cytosolic and largely hepatic where it catalyses the final step of the urea cycle [25,26]; arginase II is nonhepatic and ... monomer via partner residues that not align in sequence in the mammalian and bacterial templates In mammalian arginases, the Asp223 ⁄ 204x (rat arginase I ⁄ human arginase II) cognate forms an inter-monomer...
- 14
- 425
- 0
photographs from the edge of reality true stories about shooting on location, surviving, and learning along the way
... motorcade President Barack Obama departs the Dairy Godmother in Alexandria, Virginia 36 Ice Cream Social with Obama President Barack Obama, holding doggie treats as he and his two daughters head back ... helicopters and the Harrier Jump Jet, with its vertical takeoff and landing capability, were all flown in Accredited media received a binder of information on the arrival and location for each of the aircraft ... daughters Malia and Sasha in tow POTUS took the girls on a sugar-coated Father’s Day Eve jaunt to the Dairy Godmother, a boutique ice-cream parlor in the Del Ray section of Alexandria, VA Malia...
- 305
- 436
- 0
báo cáo hóa học:" The prosurvival activity of ascites against TRAIL is associated with a shorter disease-free interval in patients with ovarian cancer" docx
... proteomic analysis of ovarian cancer ascites demonstrated that malignant cells from ascites have higher levels of activated Akt and discriminated malignant ascites and poor survival outcomes [26] This ... anti-apoptotic activity against cisplatin, paclitaxel and TRAIL These data demonstrate that the inhibitory effect of ascites against drug cytotoxicity is heterogeneous However, ascites that have a ... protective against cisplatin Whether this is related to Akt activation by some ascites in CaOV3 cells is unclear at this point but Akt activation has been associated with the inhibition of cisplatininduced...
- 10
- 383
- 0
Báo cáo y học: " The formation of cysteine-linked dimers of BST-2/tetherin is important for inhibition of HIV-1 virus release but not for sensitivity to Vpu" potx
... performed the molecular and biochemical studies, and assisted in writing the manuscript EM performed biochemical and FACS analyses and helped with data analysis SK assisted with BST-2 mutagenesis ... TCGAG GTGGA ATTCA TGGCA TCTAC TTCGT ATGAC TATTGC and 3' AAGCT TGGTA CCTCA CTGCA GCAGA GCGCT GAGGC CCAGC AGCAC The resulting PCR product was cleaved with XhoI and KpnI and cloned into the XhoI/KpnI ... Raja N, Jabbar MA: Mutational analysis of the human immunodeficiency virus type Vpu transmembrane domain that promotes the enhanced release of virus-like particles from the plasma membrane of...
- 16
- 275
- 0
Báo cáo khoa học: Replacement of two invariant serine residues in chorismate synthase provides evidence that a proton relay system is essential for intermediate formation and catalytic activity docx
... generate the reduced flavin cofactor In the absence of oxygen, the rate of chorismate formation was six- and 70-fold lower for the Ser127Ala and Ser16Ala mutant proteins, respectively, than for the ... (Ser16Ala and Ser127Ala) and a double-mutant protein (Ser16AlaSer127Ala) In this article, we report that the replacement of both invariant serine residues (Ser16AlaSer127Ala double-mutant protein) ... Rauch et al Scheme Reaction catalyzed by chorismate synthase charge transfer) to the substrate, prompting cleavage of the C–O bond and thereby facilitating phosphate cleavage At the end of the...
- 10
- 398
- 0
The Protocol on the Rights of Women in Africa: An Instrument for Advancing Reproductive and Sexual Rights pot
... measures backed by sanctions, of all forms of female genital mutilation, scarification, medicalisation and para-medicalisation of female genital mutilation and all other practices in order to eradicate ... recognised standards and best practices; f) the right to have family planning education States Parties shall take all appropriate measures to: a) provide adequate, affordable and accessible health ... traditional conceptions of the family and the male patriarch—as stressed under the African Charter—as the sources of women’s status, rather than on the rights and standards guaranteed under international...
- 25
- 409
- 0
Báo cáo khoa học: Passage through the Golgi is necessary for Shiga toxin B subunit to reach the endoplasmic reticulum pptx
... (StxB) along a retrograde pathway from the plasma membrane through the EE ⁄ RE to the Golgi and the ER Stx takes advantage of trafficking through the Golgi to facilitate cleavage and activation of the ... cytoplasts (peripheral areas lacking a nucleus) and karyoplasts, containing the nucleus, the Golgi apparatus and the REs [48] Cytoplasts generated in this manner lack a Golgi apparatus, and importantly, ... extremely small, and must be made individually, making fractionation impossible Therefore, we used a pharmacological approach Aluminum fluoride (AlF4)) is an activator of small GTPases and is well-documented...
- 15
- 345
- 0
Prepared Statement of the Federal Trade Commission before the Internet Corporation for Assigned Names and Numbers (“ICANN”) Meeting Concerning Whois Databases Marrakech, Morocco June 2006 ppt
... to Whois data about commercial websites and other legitimate uses of Whois data, addresses the privacy concerns that some stakeholders have raised about public access to Whois databases, and concludes ... registrant’s use of false information, FTC staff was able to link the websites to each other because all of the registrations listed the same phony name as the administrative contact in the Whois ... Privacy Concerns about the privacy of domain name registrants have driven much of the Whois debate The FTC, as the primary enforcement agency for U.S consumer privacy and data security laws, is...
- 12
- 305
- 0
Báo cáo khoa học: Using directed evolution to improve the solubility of the C-terminal domain of Escherichia coli aminopeptidase P Implications for metal binding and protein stability pptx
... #1-9(157 aa) #1-21(157 aa) #1-33(143 aa) #1-40(157 aa) % R1 #2-1(157 aa) #2-5(157 aa) #2-6(157 aa) #2-13(157 aa) #2-30(157 aa) % R2 #3-15(157 aa) #3-6(157 aa) #3-8(157 aa) #3-10(157 aa) #3-15(157 aa) ... the protein to unfold (or to partially unfold) It is this unfolded form of the protein that aggregates and precipitates [23] Mutations that abolish metal binding allow the peptide to assume a ... (5¢-CCAAGCTTGTCGACGATGAGTGAGATATCC CGG-3¢) and a reverse primer (5¢-CGGGAATTCCTG CAGTTGCTTTCTCGCAGCAAC-3¢), and then cloned between the SalI and PstI sites of the DHFR fusion vector pJWL1030folA...
- 10
- 538
- 0
Báo cáo khoa học: The predominant protein arginine methyltransferase PRMT1 is critical for zebrafish convergence and extension during gastrulation pdf
... with zebrafish prmt1 cRNA (50 pg) The WT cRNA contains mismatches at the MO target site without changing the encoded amino acids The MT cRNA contains the same mismatches and mutations at the AdoMet-binding ... gene is actively and ubiquitously expressed at both RNA and protein levels at the early developmental stages of zebrafish The mRNA and protein are present before mid-blastula transition and thus are ... methyltransferase gene family in fish and ascidians Gene 340, 179–187 Scorilas A, Black MH, Talieri M & Diamandis EP (2000) Genomic organization, physical mapping, and expression analysis of the human...
- 13
- 368
- 0
d. to stay --> b 114. A artist went to a beautiful part of the country for a holiday, and stayed pdf
... men did a don't b as c to d did > d 266 A Suez Canal connects the Mediterranean Sea and the Gulf of Suez and separates the continents of Africa and Asia a A b connects c separates d of > a 267 ... one of the participants in a conversation wonders no real communication has taken place a what said the other person b what the other person said c what did the other person say d what was the ... other person saying > b The salary of a bus driver is much higher a in comparison with the salary of a teacher b than a teacher c than that of a teacher d to compare as a teacher > c Professional...
- 28
- 2,221
- 1
Báo cáo sinh học: " Virology on the Internet: the time is right for a new journal" docx
... countries (and institutions) will be able to read the same material as wealthier ones (although creating access to the Internet is another matter [10]) This is particularly relevant in virology as many ... (list available on request), and I receive royalties from these licenses I have also served on several study sections for the National Institutes of Health and currently served as the Chair of ... in, and support of, research Note that this public accessibility may become a legal requirement in the USA if the proposed Public Access to Science Act is made law [8] Similar calls for a move...
- 3
- 312
- 0
báo cáo hóa học:" Virology on the Internet: the time is right for a new journal" pdf
... countries (and institutions) will be able to read the same material as wealthier ones (although creating access to the Internet is another matter [10]) This is particularly relevant in virology as many ... (list available on request), and I receive royalties from these licenses I have also served on several study sections for the National Institutes of Health and currently served as the Chair of ... in, and support of, research Note that this public accessibility may become a legal requirement in the USA if the proposed Public Access to Science Act is made law [8] Similar calls for a move...
- 3
- 334
- 0
báo cáo khoa học: " The growing caseload of chronic life-long conditions calls for a move towards full selfmanagement in low-income countries" ppsx
... general malaise of health systems such as a maldistribution of adequately trained and well-motivated staff and a lack of affordable and reliable drugs and diagnostics [45] The poor quality of care ... the availability of professional health staff, the capacity and quality of health services, the availability of tools and infrastructure, the spread of technologies, social transitions and other ... Lopez A, Mathers C, Ezzati M, Jamison D, Murray C: Global and regional burden of disease and risk factors, 2001: systematic analysis of population health data Lancet 2006, 367:1747-1757 21 Danaei...
- 10
- 419
- 0
The age of complicance preparing for a riskier and more regulated world
... gaining access to accurate, high-quality data also hamper the quantification and analysis process The question of appropriate data and the analysis of that data is probably the biggest issue that ... view of risk and compliance depends on managing the opposing requirements for centralisation and decentralisation On the one hand, there needs to be a central function that can aggregate risk and ... their risk culture is and from there they need to define what the organisation’s risk appetite is, ” says Mr Apostolik “Then they have to ensure that the rest of the organisation works within the...
- 16
- 196
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008