tegument of schistosoma mansoni as a therapeutic target
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot
... http://jjj.biochem.sun ac.za/database/silva/index.html free of charge Results and Discussion The potential of the glyoxalase system as a possible therapeutic target relies on its role as the main catabolic pathway ... Sousa Silva et al The glyoxalase pathway in Leishmania infantum Table Glyoxalase I kinetic parameters in Leishmania infantum and other cells Initial rate analysis Glx I Substrate Km (mM) Leishmania ... the glyoxalase pathway in Leishmania braziliensis dates from 1988 [12] Only 16 years later was glyoxalase II characterized in Trypanosoma brucei [13] In this case, lactoyltrypanothione was found...
- 11
- 515
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic ... not be an absolute requirement and may be absent from many of the cases A more refined approach, based on genetic-based selection of clinically stratified T1 D subjects, may now be feasible,...
- 12
- 573
- 0
Báo cáo y học: "B cells as a therapeutic target in autoimmune disease" doc
... the US National Institutes of Health is in the planning stage 132 Although autoantibodies in autoimmune cytopenias and some other diseases, such as pemphigus and myasthenia gravis, have a direct ... immunoglobulin levels are usually maintained, possibly as a consequence of plasma cells being spared B-cell depletion in antibody-mediated diseases It is understandable that rituximab has been most frequently ... prevailing paradigm of RA pathogenesis emphasizes the role of macrophage and fibroblast activation and the production of inflammatory mediators in the synovial tissue Therapeutic effects of B-cell depletion...
- 5
- 410
- 0
Báo cáo y học: "Th2 cytokines and asthma Interleukin-9 as a therapeutic target for asthma" ppsx
... IL-9 as a candidate gene for asthma Significant biological variability in airway responsiveness in rodents has also been observed [39,40] Linkage studies in mice associate AHR with a small region ... associated with human asthma), suggesting biological effects on granulocytes [47] Mast cells are also important effector cells in asthma, and increased numbers of intra-epithelial lung mast cells ... R, Arima K, Arinobu Y, Yu B, Kruse S, Enomoto T, Dake Y, Kawai M, Shimazu S, Sasaki S, Adra CN, Kitaichi M, Inoue H, Yamauchi K, Tomichi N, Kurimoto F, Hamasaki N, Hopkin JM, Izuhara K, Shirakawa...
- 5
- 246
- 0
Polo like kinase 1 in hepatocellular carcinoma clinical significance and its potential as a therapeutic target
... this phase has been identified as a possible target of ataxia telangiectasia mutated (ATM) or ATM-related proteins (ATR), the transducers of the DNA damage signaling pathway (van Vugt et al., 2001) ... transferred to a microplate that was coated with anti-caspase-3 for hour at 37oC Substrate solution was then added for hours at 37oC after a washing step Fluorescence intensity was measured afterwards ... hours after transfection Caspase-3 activity assay was carried out (Fig 8) and intrigued to find that caspase-3 activation in si-PLK1 transfected Huh-7 was absent in the first 12 hours and 24...
- 84
- 215
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab in regulating...
- 9
- 634
- 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
... epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating characteristic analysis ... peptide-based assay (99.8%; data not shown) Further studies are in progress to compare the assay performance of the anti-SMP assay with that of other commercially available anti-Sm immunoassays For ... high-performance liquid chromatography The molecular mass was found to be 1708.1 Da (average; Precision and reproducibility Measurements of imprecision (interassay and intra-assay variability) were taken...
- 11
- 593
- 0
targeting cancer cell metabolism as a therapeutic strategy
... diphosphate ALD, aldolase ALT, alanine transaminase AKT, protein kinase B AML, acute myeloid leukemia AMP, adenosine monophosphate AMPK, AMP activated protein kinase ASCT, amino acid transporter ATP, ... into acetyl-CoA and oxaloacetate by ATP citrate lyase (ACL) Fatty acid synthesis starts with acetyl-CoA carboxylase (ACC) Barbara Julieta Chaneton, 2014 34 converting acetyl-CoA to malonyl-CoA, and ... ADP, adenosine diphosphate ; ALD, aldolase ; ALT, alanine aminotransferase; ATP, adenosine triphosphate; CS, citrate synthase; ENO, enolase; FA, fatty acids; FAD, flavin adenine dinucleotide; FASN,...
- 121
- 191
- 0
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
... with a UV detector at 232 nm The main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically ... (Mw = 200,000) was purchased from Hayashibara (Tokyo, Japan) Epirubicin·HCl (EPI·HCl) was purchased from Hisun Pharmaceutical Co (Zhejiang, China) Poly (vinyl alcohol) (PVA) with an average molecular weight ... and the acute toxicity of PANs was evaluated in mice Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats to compare to the free drug Methods Materials Pullulan...
- 7
- 391
- 0
Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats
... chloride (PAC) as well as waste steel slag (WSS) (E5) A natural tidal flat (C3) at the same tidal level was chosen as a reference for monitoring benthic communities as well as physicochemical characteristics ... in artificial tidal flats in Japan, a growth test of R philippinarum was also carried out in DS mixtures MATERIALS AND METHODS Artificial tidal flats in real seashore Five artificial tidal flats ... 2009 Fig Location of the artificial and natural tidal flats in Tategami, Ago bay, Mie, Japan Table Sediment of artificial tidal flats in real seashore Run E1 E2 E3 E4 E5 Granulation of DS 1.5wt%...
- 13
- 586
- 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry
... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release ... acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital ... feasible as great amounts of this valuable commodity would be wasted Besides lignin, miscellaneous components of wheat straw such as wax, pectin, and phenolic acids are also of great value and...
- 20
- 437
- 0
Searching for a Mate: The Rise of the Internet as a Social Intermediary potx
... women of a certain age a reasonable measure of the lack of availability of partners for single men of the same age group (and vice-versa)? Despite the existence of age discrepant couples, age homophily ... the ACS) The higher rate of interraciality in HCMST is mainly due to the fact that the HCMST survey was offered only in English, whereas the ACS was offered in a variety of languages Asians and ... Hypothesis Partnership Rate Although the association between Internet access at home and having a romantic partner is a strong and statistically significant association, several important caveats apply...
- 50
- 470
- 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
... phosphate as a substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The ... testis at stage 1, and eggs In all of the samples analyzed, a large protein peak was observed at an elution position of 72 mL (peaks a, b, c, and d), where the estimated molecular mass was about ... measured by the Bradford method [51] using a Bio-Rad protein assay (Bio-Rad, Hercules, CA, USA) with bovine c-globulin as a standard Thyroglobulin (669 kDa), catalase (232 kDa), BSA (67 kDa) and...
- 14
- 442
- 0
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt
... (2000) Autophagy as a regulated pathway of cellular degradation Science 290, 1717–1721 23 Marzella, L., Ahlberg, J & Glaumann, H (1981) Autophagy, heterophagy, microautophagy and crinophagy as the ... neurons and cardiac myocytes) for life maintenance Mitochondria are the main source of ROS formation, as well as the main target for free radical attack The accumulation of defective mitochondria within ... mitochondria have a replicative advantage over normal mitochondria [56,57] Analogous selection for dysfunctional mitochondria may also occur in the case of aging; Wanagat et al recently reported that atrophic...
- 7
- 444
- 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... no MAP band was observed (not shown) Gene and mRNA analyses of MAP1b, MAP2, Tau, and STOP The finding that apparently normal neurites are formed even when CAD cells lack MAP1b, MAP2, Tau, and...
- 14
- 416
- 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon Earhart References Argue, J (2000) Parkinson’s disease and the art of moving Oakland, CA: New Harbinger Beauchet, ... found that the waltz was just as good as traditional aerobic exercise and that people were happier, which was demonstrated by increases in a measure of quality of life, and greater likeliness ... 1989) Additionally, dance appears to be an appropriate and pleasurable therapeutic activity for the elderly, in terms of its benefits to physical, mental and emotional states (Kudlacek et al 1997)...
- 19
- 648
- 0
Báo cáo Y học: Characterization of selenoprotein P as a selenium supply protein docx
... metabolism? Proc Natl Acad Sci USA 93, 15086–15091 Saito, Y., Hayashi, T., Tanaka, A. , Watanabe, Y., Suzuki, M., Saito, E & Takahashi, K (1999) Selenoprotein P in human plasma as an extracellular ... essential trace nutrient for growth of WI-38 diploid human fibroblasts Proc Natl Acad Sci U.S .A 73, 2023–2027 Takahashi, K., Akasaka, M., Yamamoto, Y., Kobayashi, C., Mizoguchi, J & Koyama, J (1990) ... hydroperoxide was added [15] The oxidation of NADPH was followed at 340 nm at 37 °C and activity was expressed as micromoles of NADPH oxidized per minute TR enzyme assay TR activity was examined by...
- 6
- 370
- 0
A Portrait of the Artist as a Young Man ppt
... face and the voice went away Sorry because he was afraid Afraid that it was some disease Canker was a disease of plants and cancer one of animals: or another different That was a long time ago ... prefect was there again and it was his voice that was saying that he was to get up, that Father Minister had said 22 A Portrait of the Artist as a Young Man he was to get up and dress and go to ... face was pale and strange and he wore the white cloak of a marshal O how cold and strange it was to think of that! All the dark was cold and strange There were pale strange faces there, great...
- 317
- 341
- 0
báo cáo hóa học:" Angiostatin anti-angiogenesis requires IL-12: The innate immune system as a key target" docx
... Mat Control AST/Mat AST Mat 0.00 Control AST/Mat AST Mat Control 0.05 1.0 0.8 0.015 0.01 0.010 AST/Mat AST 0.000 Mat AST/Mat AST Mat 0.00 Control AST/Mat AST Control 0.005 Mat Relative expression ... S, Santi L, Cassatella M, Noonan D, Albini A: Neutrophils as a key cellular target for angiostatin: implications for regulation of angiogenesis and inflammation FASEB J 2002, 16:267-269 Wahl ... Folkman J: Inhibition of plaque neovascularization reduces macrophage accumulation and progression of advanced atherosclerosis Proc Natl Acad Sci USA 2003, 100:4736-4741 Chavakis T, Athanasopoulos...
- 8
- 477
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25