structure of oligosaccharides at the zp3 combining site for sperm
Báo cáo khoa học: Binding of ATP at the active site of human pancreatic glucokinase – nucleotide-induced conformational changes with possible implications for its kinetic cooperativity doc
... disorder in the crystal structure MD simulations of the modelled binary GK–ATP complex revealed that the global rmsd of the structure converged at the end of the 2-ns simulation period (Fig S2A) The ... helix 15) A conformational change was also indicated by the MD simulations of the modelled ternary hGK–Glc– ATP complex In the final structure of the simulations, the interactions of the adenosine ... Fig The ATP-binding site in the MD simulated model structure of the binary hGK–ATP complex and the domain motion induced by ATP binding to the hGK apoenzyme (A) Close-up view of the ATPbinding site...
- 15
- 374
- 0
Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx
... effect on the regulation of b2GPI expression The functional characterization of the b2GPI promoter would enable the targeting of regulatory regions for mutation detection Further evidence that the ... Our novel data demonstrate that the )1CfiA mutation at the transcriptional initiation site is causative, which regulates b2GPI gene expression at the transcriptional level that ultimately affects ... with the )1CfiA mutation Alternatively, other genetic or nongenetic factors modulate the effect of the )1CfiA mutation on b2GPI plasma levels We also found that the )1CfiA mutation cannot explain the...
- 9
- 462
- 0
Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"
... endothelium and resulted in the formation of atherosclerosis (9) Javid et al also found that in the early stage of atherosclerosis, the number of Cx43 gap junction plaques increased and the diameter ... formation of the atherosclerotic plaque Previous study demonstrated that rats lack of Cx43 expression showed 50% lower rate of attack with atherosclerotic plaque compared with normal rats (9) Our ... connections The present study aimed to detect the expression of Cx40 and Cx43 in the artery at early stage of high fat diet induced atherosclerosis and to investigate the effects of AT1 antagonist...
- 8
- 467
- 0
Identifying common errorss in written english of students of english at the intermediate level
... group of eighty students of English at the intermediate level of Foreign Language Department at Vinh University scopes of the study Within the limitation of a graduation thesis, we would like to ... constant theme *of history a constant theme in history *At any society In any society blamed *on the cancellation of the meeting blame for the cancellation of the meeting She prides herself *of her ... generalization of deviant structures is failure of learners to observe the restrictions of existing structure That is, the application 16 of rules to contexts where they not apply Ignorance of rule...
- 38
- 478
- 0
Tài liệu One Hundred Eleventh Congress of the United States of America - AT THE SECOND SESSION pptx
... (A) the extent of the leverage of the company; (B) the extent and nature of the off-balance-sheet exposures of the company; (C) the extent and nature of the transactions and relationships of the ... analysis of any threats to the financial stability of the United States; (B) the status of the efforts of the Office in meeting the mission of the Office; and (C) key findings from the research ... statement of the basis for the final decision of the Council, not later than 60 days after the later of (i) the date of the submission of the report under subparagraph (A); or (ii) if, not later...
- 848
- 411
- 0
Tài liệu Báo cáo khoa học: Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and catalytic control doc
... 5¢-TGTTAATTAACGAAAATGCTGAAGTGATGTTTT TC-3¢ (forward); 3¢-GAAAAACATCACTTCAGCATTT CGTTAATTAAC-5¢ (reverse); Asp40Asn: 5¢-GGTGTT AATTAACGAAAATAACGAAGTGATGTTTTTCA AC-3¢ (forward); 3¢-GTTGAAAAACATCACTTCGTTA ... cyanide binding provide valuable information on the haem distal structure of Ec DOS PAS [17] As the structure of the cyanide-bound complex of FixL is similar to that of its oxygen-bound complex [10], ... are only slightly higher than that (0.045 mM)1Æs)1) of the wild-type protein (Table 2) The data indicate that mutation of Asp40 at the haem proximal side alters the cyanide binding property only...
- 6
- 423
- 0
BCKH DETERMINANTS OF CAPITAL STRUCTURE OF LISTED MANUFACTURING THE CASE IN VIETNAM
... Miller, M.H, (1958), The Cost of Capital, Corporate Finance,and the Theory of Investment” American Economic Review Rajan, R G & Zingales, L, (1995), “What we know about capital structure? Some evidence ... “Determinants of capital structure for listed firms in the Vietnam stock Exchange Market” Danang University Press, Danang, Vietnam Stata Web Book University of California, Los Angeles Panel data analysis ... structure? Some evidence from international data” The Journal of Finance Trần Đình Khôi Nguyên (2006) “Capital structure in small and medium-sized enteprises: the case of Vietnam” ASEAN Economic Bulletin...
- 9
- 618
- 2
Báo cáo "QUATERNARY GEOLOGICAL MAP OF THE CONTINENTAL SHELF OF VIETNAM AT THE SCALE OF 1:1,000,000 " potx
... Vu The selection of scale of the map is very important for interpretation and performance of geological formation on the map Stratigraphical boundaries in Quaternary are divided by comparison the ... another coral platform was produced at recent depth of 2-3 meters The active transgression has produced coral platform and wave-cut bench The corals of Paracel and Spratley Corals had a large atoll ... as the South Central part of Vietnam, subsidence had occurred periodically (cycliclty) for whole basins both on the land and in the ocean area Therefore, the coarse layer in the lower part of the...
- 10
- 404
- 0
Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt
... peptides, the absence of consensus residues in the active site results in probable lack of any antiprotease activity [5] Then, the purification of the binding site, and the cloning of the corresponding ... cooling at room temperature, one volume of 0.2 M iodoacetamide was added and the mixture was incubated in the dark for h Alkylation of the cysteine residues was quantitative, and the alkylated peptide ... total volume of 204 lL The nonspecific binding component was determined in the presence of lM nonlabeled mixture of the PA1b isoforms Incubations were performed for h at room temperature in 96-well...
- 7
- 604
- 0
Báo cáo khoa học: Molecular mass of macromolecules and subunits and the quaternary structure of hemoglobin from the microcrustacean Daphnia magna ppt
... [2,4,8,11,12,42] offers the chance to relate the structure and function of this interesting molecule The present study has contributed to this approach: (a) the determination of the molecular mass of the native ... identified on the basis of their mass spectra, their retention times and characteristic ratio of the a- and b-anomers Analysis of phosphorylation For the detection of possible phosphorylation, Hb of red ... calculate the number of subunits in the native aggregate Based on the molecular mass of macromolecule and subunits, the number of subunits per macromolecule can be calculated For red D magna, the...
- 18
- 499
- 0
Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc
... methods in the characterization of GAGs is becoming more important now that full structural information for large domains is required as part of the examination of function for these species Data from ... paradigm of isolation and depolymerization of GAG chains to generate oligosaccharides, the structures of which are determined using NMR spectroscopy [6,16] These oligosaccharides are then integrated ... endolyase at 20 mgÆmL)1 in 0.1 m Tris ⁄ HCl, pH 8, at 37 °C for 15 h The enzyme was inactivated by heating at 100 °C for min, and the oligosaccharides generated were reduced by the addition of 25...
- 11
- 481
- 0
Báo cáo khoa học: Examining multiprotein signaling complexes from all angles The use of complementary techniques to characterize complex formation at the adapter protein, linker for activation of T cells pdf
... shown that the formation of LATmediated signaling complexes play a complex role in the differentiation and homeostasis of T-cell populations, the maturation of B cells and the activation of mast ... associate with LAT is still controversial The result of the formation of LAT-mediated complexes is the activation of signaling pathways and the induction of effector functions binding of various ... combination of affinity preferences (the explanation for the lack of in vivo binding of Gads to phosphorylated LAT tyrosine 132) and the formation of multiprotein signaling complexes (the reason for...
- 10
- 457
- 0
Báo cáo khoa học: The crystal structure of pyruvate decarboxylase from Kluyveromyces lactis Implications for the substrate activation mechanism of this enzyme ppt
... deprotonation of the C2 atom of the thiazolium ring (marked by an asterisk) The resulting ylid of ThDP (I) can attack the carbon atom of the carbonyl group of the substrate pyruvate, generating ... (Fig 5) The amino acid arrangement at the active site enforces the so-called V-conformation of ThDP [17] This relative orientation of the pyrimidine ring and the thiazolium ring is one of the three ... aminopyrimidine ring of ThDP is bound at the PYR domain of one subunit The diphosphate residue is bound to the PP domain of the other subunit at the same dimer together with the octahedral coordinated Mg2+...
- 11
- 374
- 0
Controlling the Structure of Generated Servlets The JSP page Directive
... generated How multithreading is handled If the servlet participates in sessions The size and behavior of the output buffer What page handles unexpected errors The import Attribute • Format – ... Oranges
- 14
- 227
- 0
Báo cáo y học: "Summary of presentations at the NIH/NIAID New Humanized Rodent Models 2007 Workshop" ppsx
... nodes Therefore, further dissection of the mechanism of human T cell maturation in this system could provide new methods to increase the qualitative function of T cells that mature in the human ... into the mechanism for lymphocyte homing to the gut and other http://www.aidsrestherapy.com/content/5/1/3 mucosal areas For example, is it a consequence of the different location of maturation of ... reflect the views of the Division of AIDS, the National Institute of Allergy and Infectious Diseases, the National Institutes of Health, or any other governmental agency Presenters at the workshop...
- 14
- 409
- 0
báo cáo khoa học: "Localization of DIR1 at the tissue, cellular and subcellular levels during Systemic Acquired Resistance in Arabidopsis using DIR1:GUS and DIR1:EGFP reporters" ppsx
... from the ER and the secretory system Nevertheless, these data support the idea that some DIR1 protein is present in the cytosol and therefore Page 11 of 16 gains access to the phloem through the ... [64-68] Therefore, we speculate that the difference in timing of suppression of DIR1 expression in these two experiments is due to the high versus low inoculum doses used Collectively, these data ... suggesting that this mutant is defective either in the synthesis of the SAR mobile signal or its transport to distant leaves [21] These data and the fact that DIR1 encodes a putative lipid transfer...
- 16
- 233
- 0
báo cáo khoa học:" Quality of life at the dead sea region: the lower the better? an observational study" pptx
... and HRQOL The results of previous studies have demonstrated the advantage of the DS region for climatotherapy Most of these studies examined the health benefits of the DS region for patients with ... came to the DS for treatment None of these studies assessed permanent residents of the DS region to determine whether the affects of this unique climate are beneficial to residents of the region ... desert climate, except for the differences in barometric pressure and UV radiation Materials and methods Study population The study population was comprised of kibbutz residents in the southern desert...
- 7
- 400
- 0
Structural basis of protein stability at poly extreme crystal structure of amya at 1 6 a resolution
... on the structure that gives rise to that reflection and is independent of the method and conditions of observation of the reflection The set of structure factors for all the reflections are the ... the resultant of N waves scattered in the direction of the reflection hkl by the N atoms in the unit-cell Each of these waves has an amplitude, which is proportional to the sum of fj, the scattering ... several derivatives are combined for the refinement of heavy atom parameters and for the calculation of MIR or MIRAS phases 1.5.5 Anomalous scattering The atomic scattering factor of an atom has...
- 25
- 221
- 0
Structural basis of protein stability at poly extreme crystal structure of amya at 1 6 a resolution 3
... difference in the Tm Figure 3.1 The CD spectra of AmyA at different salt concentration The CD spectra monitored at 222 nm demonstrating the thermal denaturation of AmyA at different NaCl concentration ... rate of 0.5 ml min-1 61 3.3 RESULTS 3.3.1 Thermal stability at different salt concentrations To understand the relationship between the presence of salt and the thermal stability of AmyA, temperature ... assay of AmyA at different NaCl concentration before and after the incubation of the AmyA sample in boiling water for 30 minutes Addition of as low as mM NaCl or CaCl2 to this solution decreased the...
- 9
- 162
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25