... 9 /14 E 5/ 14 K II D 19 /19 E I D 9 /10 E 1/ 10 K 11 /11 E 2 /7 V N K N H 6 /14 D K N N N T 13 / 15 A 2/ 15 T 5/ 12 A7 /12 T 1/ 3 A 12 /13 T T T K 15 / 15 K 7 /12 E 3 /13 K 12 /12 E 4 /12 T 1/ 12 K 10 /13 N 12 / 15 ... Ser 11. 2% Phe 0.2% Tyr 0% V A 5/ 16 V 11 /16 V 15 / 15 V 10 /10 A 4 /13 A 4 /14 V K 6/8 K 5/ 14 R 1/ 8 E 1/ 8 Q 8 /14 R 1/ 14 V 3 /12 V 6/8 V 6 /14 F 5/ 12 A 4 /12 F 2/8 Y 8 /14 G 13 /13 E 14 /19 K 14 /14 K 19 /19 ... found in the 50 0 sequences database K T R T 13 / 15 T 6 /14 I 1/ 15 A 1/ 15 I 8 /14 R 11 /13 R 3/ 15 R 8 /14 K 2 /13 Arg 81. 3% Lys 18 .4% Met 0% T T 4 /13 I 9 /13 476 Thr 81. 3% Iso 3 .1% Ala 1. 7% K 12 / 15 T...
... 44–48 19 Kito, Y., Naito, T & Nashima, K (19 82) Purification of squid and octopus rhodopsin Methods Enzymol 16 7 17 1 20 Nakagawa, H., Kawamura, Y., Kato, K., Shimada, I., Arata, Y & Takahashi, N (19 95) ... 13 0 13 8 21 Takahashi, N., Nakagawa, H., Fujikawa, K., Kawamura, Y & Tomiya, N (19 95) Three-dimensional elution mapping of pyridylaminated N-linked neutral and sialyl oligosaccharides Anal Biochem ... reducing end GlcNAc When subjected to linkage analysis, glycan B1 gave terminal Fuc, terminal Man, terminal Gal, 3,6-linked Man, 4-linked GlcNAc and, importantly, a peak that can be assigned as...
... of infant deaths in the neonatal period compared to that in the 78 9 DUTT AND SRINIVASA post-neonatal period had also changed since 19 67 Between 19 67 and 19 71 the post-neonatal mortality had been ... Government of India National Health Policy New Delhi, Ministry of Health and Family Welfare 19 83; pp 1- 7 11 Srinivasa DK, Danabalan M, Anand D Infant mortality trends ina rural health center of ... Disabilities, 19 91; pp 47 - 51 13 Anderson GC, Marks EA, Wahlberg B Kangaroo care for premature infants Am J Nurs 19 86; 86: 8 07- 812 14 Dutta SP, Srinivasa DK, Kale RV Mortali ty trends in villages of Rural...
... (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used Quantification of the splicing ratio by RT-PCR was performed using the forward primer radiolabeled ... mm MgCl2 and 10 0 mm KCl at 37 °C for prior to partial cleavage by 0. 05 UÆlL )1 RNase T1 (Fermentas, China), 0.0 01 lgÆlL )1 RNase Aand 0.0 01 UÆlL )1 RNase V1 (Ambion, Austin, TX, USA) at 37 °C for ... 278 (2 011 ) 15 3 3– 15 4 6 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 15 4 5A structured RNA in HBV genome regulates alternative splicing C Huang et al involvement of polypyrimidine tract binding...
... representations by back-propagation errors,” Nature, vol 323, pp 53 3 53 6, 19 86 B Hassibi and T Kailath, “Optimal training algorithms and their relation to backpropagation,” in Advances in Neural Information ... Van Dyck, andA Soltanian, “Interference of bluetooth and IEEE 802 .11 : simulation modeling and performance evaluation,” in Proc 4th International ACM Workshop on Modeling, Analysis and Simulation ... signal in an explicit and robust way; (ii) obtaining such a result by a low computational load Time-Frequency Analysis for Mode Identification 17 83 10 7 10 75.55 4 Frequency Frequency 4 .5 3.5...
... branches per seedling 1. 4 1.1 37 0 .7 1. 084 * Number of leaves per seedling 14 .9 6. 018 8 .7 3.399 ** Leaf area per seedling (cm2) 19 8.6 63. 670 16 0.2 35. 214 * Average area of leaf (cm2) 14 .1 3 .10 4 ... (Table 3) Seedlings grown in the sun were larger and had more branches and leaves Their total leaf area and dry matter of all leaves per seedling were higher But average leaf area and average ... = 10 0) Variant Sun Shade t-value Significance 4.0 61 0.0 05 – 15 . 60 1. 209 3. 872 ** 0.940 3 .73 0 .78 0 11 . 2 57 ** 4.00 1. 428 2.40 0.929 9. 15 9 ** Volume of thick roots (ml) 3 .70 1 .50 4 2 .10 0. 911 8 .78 6...
... increasing porosity (Biswas and Koshla, 19 71 ; Hall and Coker, 19 83), and favour infiltration processes and water- holding capacity (Gupta et al, 19 77 ; Khaleel et al, 19 81) Mechanical terracing of ... Murcia, Spain, 11 7 -13 7 Glaub JC, Gouleke GG (19 89) Municipal organic wastes and composts for arid areas Arid Soil Res Rehab 3, 17 1 -18 4 Gonzalez Alonso S (19 89) Guias Metodológicas para la Elaboración ... Conditions (J Albaladejo, MA Stocking, E Diaz, eds), CSIC, Murcia, Spain, 19 1- 214 Albaladejo J, Stocking MA, Diaz E, Castillo V (19 94) Land rehabilitation by urban refuse amendments ina semi-arid environment:...
... least 10 cm in diameter at breast height (DBH) in the Paracou forest are the Lecythidaceae (18 % of the individuals), the Caesalpinaceae (13 %) and the Chrysobalanaceae (12 %) [11 ] The principal ... dying have smaller initial heights and diameters (for initial diameters: median ters 1- way analysis chi-square 7. 228; 1; P < 0.01for Goupia glabra; analysis chi-square 5.7 45; df 1; P < 0. 05 = ... species [ 17 ] Mature trees are emergent, with height surpassing 40 a maximum m [12 , 20] anda lifespan of more than 10 0 years Bocoa prouacensis, Pradosia cochlearia and Goupia glabra are among the 14 ...
... found in the mangrove forests are Rhizophora mangle, Avicennia germinans, Avicennia schaueriana, and Laguncularia racemosa [ 17 ] Data collection and analyses Our research was undertaken between January ... saberes tradicionais na conservação de manguezais da Amazônia brasileira Estudos Feministas 20 07, 15 : 4 85- 490 41 Mendon a JT, Pereira ALC: Avaliação das capturas de caranguejo-uçá Ucides cordatus ... Memórias Instituto Oswaldo Cruz 20 05, 10 0 :16 1 -16 7 19 16 Maneschy MC: Ajuruteua, uma comunidade pesqueira ameaçada UFPA University Press, Belém, Brazil; 19 95 17 CEPEMAR: Monitoramento Manguezal...
... wall, including the parietal pleura and intercostal muscles, led to a complete and well-made obliteration of the residual pleural space A chest tube anda subcutaneous drainage were placed and ... thoracic incision was sutured Finally, an abdominal aspirative drainage was inserted and the laparotomy was closed Figure bronchopleural fistula (white arrows) Axial CT scan (window setting) ... fistula was present Conclusion Drainage of the infected pleural space, antibiotics to treat infection, and accurate clearance of secretions from the remaining lung should be the initial treatment...
... programme and internal programme organisation Instead of a single-level change approach, the literature suggests a strategy that involves actors at all organisational layers–from physicians and ... redesign 26 3.3 1 -5 55 6.9 2 -16 Working without waiting lists Total 26 3.3 1 -5 57 7 .1 2.3 1 -5 2 97 6.2 0-23 3a 3 -14 10 7 Year a Four medication safety projects were disseminated hospital-wide, but ... study LV acquired and analysed MQC data CW, LV, and PPG assisted in interpreting the results and revising the manuscript for intellectual content All authors have read and approved the final manuscript...
... Globalization and Health 2 011 , 7 :10 http://www.globalizationandhealth.com/content /7 /1/ 10 project team included: Soumita Basu, Gitanjali Priti Bhatia, Samita Bhattarai, Erin Court, Abhijit Das, ... Medicine; 20 05 doi :10 .11 86 / 17 44-8603 -7 -10 Cite this article as: Brhlikova et al.: Trust and the regulation of pharmaceuticals: South Asia ina globalised world Globalization and Health 2 011 7 :10 ... the ‘multinational’ brands (by which he meant Indian Brhlikova et al Globalization and Health 2 011 , 7 :10 http://www.globalizationandhealth.com/content /7 /1/ 10 branded drugs) rather than Nepali ones...