0

some words miss a few letters listen and fill them in then work with a partner to compare the answers

Báo cáo khoa học:

Báo cáo khoa học: "Combining a Statistical Language Model with Logistic Regression to Predict the Lexical and Syntactic Difficulty of Texts for FFL" potx

Báo cáo khoa học

... becoming available, and data mining approaches may become applicable to the textcategorization problem for FFL readability Support vector machines have already been shown to be useful for readability ... evaluation measures we had chosen, as well as a better insight into the generalisability of the two models The resulting evaluation measures for training and test folds are shown in Table The ... J Callan, and M Eskenazi 2007 Combining lexical and grammatical features to improve readability measures for first and second language texts In Proceedings of NAACL HLT, pages 460–467 P.-N Tan,...
  • 9
  • 514
  • 0
Money and happiness a guide to living the good life

Money and happiness a guide to living the good life

Tâm lý - Nghệ thuật sống

... importantly, understand how to manage it so it maximizes their happiness They have defined the good life” in a way that’s authentic to them, and use money to realize a personal vision Back in the ... saving, and investing, with a special look at money and relationships and what to when you achieve certain financial milestones The goal is to connect these financial concepts to real life, so the ... offers a road map to wealth with practical financial tools and positive strategies for creating the good life” in a personally meaningful way It looks at how to identify our authentic values and...
  • 258
  • 358
  • 0
Greener Events A guide to reducing the environmental impacts of conferences and seminars potx

Greener Events A guide to reducing the environmental impacts of conferences and seminars potx

Tổ chức sự kiện

... issues to be addressed in choosing the venue as well as in organising and running the event And finally… don’t forget to tell your delegates that the event has been arranged in partnership with the ... marketing makes consumers more aware of and interested in the origin of food, helping to improve their links with and understanding of the rural economy, food production, land management and rural ... conferences and seminars, where there is a specific need to gather many delegates and speakers together in one place, there are significant opportunities available for ensuring that environmental impacts...
  • 5
  • 527
  • 0
báo cáo hóa học:

báo cáo hóa học: " Soluble HLA measurement in saliva and cerebrospinal fluid in Caucasian patients with multiple sclerosis: a preliminary study" pdf

Hóa học - Dầu khí

... technique after the informed consent was reviewed with the patient and signed Brain MRI was performed using a 1.5 T machine with a standard quadrature head coil The imaging protocol included sagittal ... due, at least in part, to the HLA allospecificities [16-18] Racial-ethnic factors may also have an influence on sHLA levels [18,19] Thus, it appears advantageous to assess sHLA measurements in ... identified as sHLA proteins, into the surrounding fluids as this may translate into a biological monitor of autoimmune disease activity However, the pathways responsible for, and the potential pathophysiological...
  • 7
  • 326
  • 0
báo cáo khoa học:

báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx

Báo cáo khoa học

... receptor status in invasive ductal and lobular carcinomas [9] But the labelling index of cyclin D1 correlated with the pathological stage of the disease in invasive lobular carcinomas but not in invasive ... similar for IDC (infiltrating ductal carcinomas) Grade, lymph node spread and vascular invasion were still significant in a stepwise multivariate analysis for all invasive carcinomas and the subgroup ... statistical associations p27 Cyclin E All invasive carcinomas Infiltrating duct carcinomas only All invasive carcinomas Infiltrating duct carcinomas only Distant metastases 0.85 0.54 0.04 0.02 Grade...
  • 9
  • 423
  • 0
Báo cáo y học:

Báo cáo y học: "The association between disease activity and NT-proBNP in 238 patients with rheumatoid arthritis: a 10-year longitudinal study" pptx

Báo cáo khoa học

... assessments of clinical and radiographic data at baseline and after and 10 years [15] The patients had all been recruited to the EUropean Research on Incapacitating DIsease and Social Support (EURIDISS) ... deals with missing values by assuming them to be missing at random without removing the individual from the dataset We investigated the change in NTproBNP levels over time and examined associations ... NT-proBNP in the linear regression analyses (Table 2) This significant association was also maintained in the multivariate linear regression analyses, which included the interaction between age and...
  • 7
  • 407
  • 0
Báo cáo y học:

Báo cáo y học: "Safety and Effectiveness of two treatment regimes with tranexamic acid to minimize inflammatory response in elective cardiopulmonary bypass patients: a randomized double-blind, dosedependent, phase IV clinical trial." pdf

Báo cáo khoa học

... Hospital Universitario de Canarias Ofra s/n, La Cuesta 38320-La Laguna Espa a 4Hematology Laboratory Hospital Universitario de Canarias Ofra s/n, La Cuesta 38320-La Laguna Espa a 5Biochemical laboratory ... preoperative clinical and analytical data collection All authors read and approved the final manuscript Page 10 of 10 17 18 19 Competing interests The authors declare that they have no competing interests ... laboratory Hospital Universitario de Canarias Ofra s/n, La Cuesta 38320-La Laguna Espa a Cardiac Surgery Department Hospital Universitario de Canarias Ofra s/n, La Cuesta 38320-La Laguna Tenerife...
  • 10
  • 414
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Regeneration of human bones in hip osteonecrosis and human cartilage in knee osteoarthritis with autologous adipose-tissue-derived stem cells: a case series" docx

Báo cáo khoa học

... hip pain improved About a month prior to presentation, she again started having hip pain radiating to the anterior region of the right knee The pain was worse when standing up, walking, and exercising ... [6] Also, it is believed that a scaffolding material might be needed to allow the MSCs to attach and engraft [7] Platelet-rich plasma (PRP) was used as a growth factor and as a differentiating agent ... After cleaning with povodine-iodine and draping with sterile drapes, her knee was anesthetized with 2% lidocaine at the medial and lateral sides of the inferior patella Using a 22-gauge 1-inch needle,...
  • 8
  • 293
  • 0
Báo cáo y học:

Báo cáo y học: " Mimicking microbial ‘education’ of the immune system: a strategy to revert the epidemic trend of atopy and allergic asthma?" ppt

Báo cáo khoa học

... in those ‘unhygienic’ areas inhale and ingest a different kind, variety and amount of bacteria compared with children of farmers and anthroposophic families, who have access to natural soil and ... that gut flora may affect the induction of oral tolerance has promoted calls for clinical trials aimed at establishing whether lactobacilli-containing preparations are useful in allergic diseases ... extracts ‘Immunoeducation’: a novel strategy or an utopian goal? Bacteria or bacterial products are already being tested against allergic diseases Encouraging preliminary data are coming from animal...
  • 4
  • 335
  • 0
Exact modeling of multiple access interference, ber derivation and a method to improve the performance of UWB communication systems

Exact modeling of multiple access interference, ber derivation and a method to improve the performance of UWB communication systems

Tổng hợp

... Furthermore, the channel gain is modeled as a log-normal random variable Therefore, in order to make the analysis theoretically tractable, certain simplifying assumptions are made The channel gain h ... of the systems ability to recover the information successfully In fading channels, where the instantaneous SNR is a random variable, the average SNR is used as the measure Another standard measure ... important in evaluating and comparing new and existing technologies to choose the right candidate for the purpose of implementation or standardization It is important to have theoretical tools to evaluate...
  • 104
  • 421
  • 0
islcollective worksheets preintermediate a2 high school listening wor listen and fill in the grid 79324805355868104731926 58275074

islcollective worksheets preintermediate a2 high school listening wor listen and fill in the grid 79324805355868104731926 58275074

Tiếng Anh

... Sue Robin Rebecca Mia Patricia What about you? What did you use to do? ...
  • 2
  • 275
  • 0
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

Quản trị kinh doanh

... brand awareness, brand association and other propriety assets According to him, Brand loyalty has to with the level of devotion a consumer has to a brand Brand awareness has to with the ability ... in the mind of consumers thereby increasing the brand equity Pitta and Katsanis (1995) also stated that a unique, favorable and strong brand image allows the brand to be easily differentiated and ... Achieving brand awareness Aaker (1991) prescribed some of the following factors as ways to achieve brand awareness: • Involve a slogan or jingle: a slogan is a visible feature of a brand There can...
  • 88
  • 986
  • 8
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Báo cáo khoa học

... (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with ... cells can maintain homolactic fermentation The fact that the effects of PK and LDH almost cancel each other out may also add to the explanation of why the genes are organized in an operon in L lactis...
  • 12
  • 616
  • 0
Tài liệu Multiple Equilibria and Minimum Wages in Labor Markets with Informational Frictions and Heterogeneous Production Technologies pot

Tài liệu Multiple Equilibria and Minimum Wages in Labor Markets with Informational Frictions and Heterogeneous Production Technologies pot

Tự động hóa

... Referees, Katarina Richardson, Audra Bowlus, Jim Albrecht, Arie Kapteyn, and participants at the SED 1999 meeting and at seminars and workshops at Chicago, Bonn, Aarhus, Maastricht, and Amsterdam, for ... Antecol P Kuhn S J Trejo Assimilation via Prices or Quantities? Labor Market Institutions and Immigrant Earnings Growth in Australia, Canada, and the United States 06/03 803 R Lalive Social Interactions ... Program: Evidence from a Prototypical Job Training Program 06/03 799 R A Hart General Human Capital and Employment Adjustment in the Great Depression: Apprentices and Journeymen in UK Engineering...
  • 35
  • 346
  • 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

Báo cáo khoa học

... Morphological study of the mammalian stress response: characterization of changes in cytoplasmic organelles, cytoskeleton, and nucleoli, and appearance of intranuclear actin filaments in rat fibroblasts after ... cells are sufficient to initiate signal transduction [33], i.e changes in lipid dynamics in the plasma membrane can serve as a link between mechanical force and chemical signaling In fact, BA has ... cells, analogously with heat-induced plasma membrane fluidization, are indeed capable of activating HSP formation even at the growth temperature, without causing measurable protein denaturation We also...
  • 10
  • 452
  • 0
A Strategy to Engage the Private Sector in Climate Change Adaptation in Bangladesh docx

A Strategy to Engage the Private Sector in Climate Change Adaptation in Bangladesh docx

Quỹ đầu tư

... role to play in generating data and developing models, and making those available to the private sector, and in leading by example by screening investments against climate change Protecting the ... of losing them, and falling into debt Thus, a critical task for the public sector will be to support the private sector in creating financial risk sharing and management approaches and mechanisms ... cyclones with higher wind speeds and storm surges leading to more damage in the coastal region Heavier and more erratic rainfall in the GangesBrahmaputra-Meghna system, including Bangladesh, during the...
  • 49
  • 557
  • 0
Báo cáo khóa học: Characterization of presenilin complexes from mouse and human brain using Blue Native gel electrophoresis reveals high expression in embryonic brain and minimal change in complex mobility with pathogenic presenilin mutations pptx

Báo cáo khóa học: Characterization of presenilin complexes from mouse and human brain using Blue Native gel electrophoresis reveals high expression in embryonic brain and minimal change in complex mobility with pathogenic presenilin mutations pptx

Báo cáo khoa học

... as an apparent complex in membranes from the human neuroblastoma cell line SY5Y using PS1 Ab 98/1 and C-terminal NCT Ab 00/ 19 (Fig 2A) We investigated further these apparent changes in PS1 and ... Honda, T., Nihonmatsu, N., Yasutake, K., Ohtake, A. , Sato, K., Tanaka, S., Murayama, O., Murayama, M & Takashima, A (2000) Familial Alzheimer’s disease-associated mutations block translocation ... were compared for immunoreactivity with antibody as indicated BACE was detected as a broad smear of apparent molecular mass greater than 440 kDa PS2 was detected as a band of  420 kDa determine...
  • 11
  • 488
  • 0
Báo cáo

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Báo cáo khoa học

... their  living;  they  need  to maintain  their  families.  Also  because  of  the relative  large  initial  investment costs they are in debt and have to repay the banks in short terms.  The ... The final step in evaluating the measures  is  to determine  the weights  for  the alternatives. By referring to the standardized  scores in Tables 5 and 7, and scoring card of  combinations  in Table  ... noted that MCA is subjective in its nature. In case  the quantitative  data  are  available,  quantitative  analysis  (i.e.  numerical  modelling)  can  be  used  in combination  with MCA to arrive at the ʺbestʺ solution(s) in the ...
  • 13
  • 487
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25