single motor starter with a single pushbutton control station with relay controlled motor starter and status indicator lamps
Motor control fundamentals - Tài liệu kỹ thuật
... world adopted the IEC standard NEMA standard MG-1 (Motors and Generators 1) sets the standard for the construction and manufacture of AC and DC motors and generators, and will be the main standard ... Induction Motor Electrical Connections Motor Nameplates Motor Nameplate Information Magnetic Relays and Contactors Parts of a Relay Magnetic Contactors 40 45 53 54 Chapter 12 Chapter 13 Chapter 14 Chapter ... referenced IEC standard 60034-1 pertains to all rotating electrical machines and will be referenced for comparison with the NEMA standard Both NEMA and IEC motors and motor control components are common...
- 210
- 372
- 0
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... Yasuda, T., Sawazaki, K., Nadano, D., Takeshita, H., Nakanaga, M & Kishi, K (1993) Human seminal deoxyribonuclease I (DNase I): purification, enzymological and immunological characterization and ... snakes and Japanese white rabbits were acquired, maintained and used in accordance with the Guidelines for the Care and Use of Laboratory Animals (NIH, USA; revised 1985) Analytical methods DNase ... (lanes 1, and 5) and recombinant (lanes 2, and 6) enzymes were used Lanes and 2, E quadrivirgata enzyme; lanes and 4, E climacophora enzyme; lanes and 6, A blomhoffii enzyme The cathode is at the...
- 8
- 500
- 0
Báo cáo y học: " Factors associated with late presentation to HIV/AIDS care in South Wollo ZoneEthiopia: a case-control study" pps
... living with HIV/AIDS and health workers allowed a cross-validation of data and possibly a minimization of biases Using case -control study design for assessing factors associated with late presentation ... Mazimba A, Seidenberg P, et al: Barriers to initiation of antiretroviral treatment in rural and urban areas of Zambia: a crosssectional study of cost, stigma, and perceptions about ART Journal ... showed association with late presentation to HIV/AIDS care in the bivariate analysis such as occupational status at HIV diagnosis, area of residence, marital status, living arrangements, ownership...
- 6
- 381
- 0
Báo cáo y học: "A single-tube allele specific-polymerase chain reaction to detect T315I resistant mutation in chronic myeloid leukemia patients" pdf
... (5’-TGGTTCATCATCATTCAACGGTGG-3’) and WT_R (5’-GTTCCCGTAGGTCATGAACTCAG3’), and 3) internal control primers, forward (b-actin_F) (5’-gtggggcgccccaggcacca-3’) and b-actin_R (5’-gtc cttaatgtcacgcacgatttc-3’) ... primers: B 2A _f 5’-acagcattccgctgaccatcaataag-3’ and reverse primer: BA_r 5’-atggtccagaggatcgctctct-’3) [8] The reaction mixture was placed in a thermal cycler (Veriti, Applied Biosystems, CA) under ... to amplify two partially overlapping fragments consisting of fragment forward primers: abl_1F (5’-tggttcatcatcattcaacggtgg-3’) and reverse primers: abl_1R (5’-tctgagtggccatgtacagcagc-’3), and...
- 7
- 439
- 0
Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps
... Shirakawa I, Deichmann KA, Izuhara I, Mao I, Adra CN, Hopkin JM: Atopy and asthma: genetic variants of IL-4 and IL-13 signalling Immunol Today 2000, 21:60–64 105 Takabayashi A, Ihara K, Sasaki ... emphasis away from linkage analysis and microsatellite markers towards SNP genotyping and different analytical strategies based on association and haplotype analysis [31–34] Association analyses are ... Sasaki S, Adra CN, Kitaichi M, Inoue H, Yamauchi K, Tomichi N, Kurimoto F, Hamasaki N, Hopkin JM, Izuhara K, Shirakawa T, Deichmann KA: Genetic variants of IL-13 signalling and human asthma and...
- 11
- 491
- 0
AN1292 sensorless field oriented control (FOC) for a permanent magnet synchronous motor (PMSM) using a PLL estimator and field weakening (FW)
... certification for its worldwide headquarters, design and wafer fabrication facilities in Chandler and Tempe, Arizona; Gresham, Oregon and design centers in California and India The Company’s quality ... estimator cycle The stator’s inductance (LS) and resistance (RS) in Equation 4, are normalized and adapted to ease the computation and to satisfy the software representation requirements, as shown ... obtain the star connected motor equivalent phase resistance and inductance – RS and LS This voltage constant, ΚΦ , is indicated by all motor manufacturers; however, it can be measured using a...
- 20
- 430
- 0
A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi
... observation and reasoning With the above classification, we can carry out two categories of tests, namely, empirical tests and rational tests with and without field data (Fig 2.1) Rational tests can ... like a river or an estuary to a complete water system such as a river basin or a coastal area These changes result in integrated coastal-zone management, integrated river basin management and/ or ... formulation, which aims at identifying, analyzing and evaluating management strategies, is that of policy analysis 22 Chapter1 Policy analysis and rapid assessment models According to Miser and...
- 139
- 492
- 0
Development of a method to measure consumer emotions associated with foods
... can get acquainted with the ballot more quickly and shorten the task over each sample evaluation We compared this alphabetized approach with a randomized attribute presentation and found that ... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, affectionate, ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited via internet and/ or phone based on...
- 10
- 781
- 3
Tài liệu Using a DataView to Control Edits, Deletions, or Additions in Windows Forms pdf
... deleting the data in the control Binding a DataGrid to a DataTable binds to the default view of the underlying DataTable The DataView class represents a view of the DataTable that can be data bound ... System.Data; using System.Data.SqlClient; private DataView dv; // private void ControlDataEditWithDataViewForm_Load(object sender, System.EventArgs e) { // Fill the Order table SqlDataAdapter da ... Table 7-14 control the data modification permitted in a DataView Table 7-14 DataView properties Property Description AllowDelete Gets or sets a Boolean value indicating whether deletes are allowed...
- 3
- 532
- 0
Tài liệu FlexWave™ WMX 3000 WiMAX Single-sector Base Station ppt
... bypass and extended Wi-Fi coverage • Fixed WiMAX service evolving to support mobile subscribers • Bandwidth hungry video and data applications requiring low latency and predictable performance ... FlexWave™ WMX 3000 WiMAX Single- sector Base Station The FlexWave™ WMX 3000 operates in licensed and license-exempt bands under virtually all wireless conditions including LOS, OLOS, and NLOS, ... consists of a spectrum-specific radio and antenna connecting to the indoor unit via coax cable carrying power, timing, and control signals www.adc.com • +1-952-938-8080 • 1-800-366-3891 FlexWave™ WMX...
- 4
- 293
- 0
Tài liệu Updating a DataSet with a Many-to-Many Relationship ppt
... FIELD2_FIELD); daParent.InsertCommand = insertCommand; // Build the parent update command SqlCommand updateCommand = new SqlCommand(UPDATEPARENT_SP, daParent.SelectCommand.Connection); updateCommand.CommandType ... updateCommand.Parameters.Add(FIELD4_PARM, SqlDbType.NVarChar, 50, FIELD4_FIELD); daChild.UpdateCommand = updateCommand; // Create the ParentChild DataAdapter daParentChild = new SqlDataAdapter(GETPARENTCHILD_SP, ... by creating a DataSet containing a parent, child, and many-to-many junction table, as well as the DataRelation objects between them A DataAdapter object is created for each table and the stored...
- 19
- 304
- 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG ... Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC ... 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO 3¢rpsO 3¢rpsO 3¢rpsO-(T)18 rpsO internal 3¢rpsO-(C)18...
- 10
- 488
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned ... TP901-1 phage attachment site PCR products upstream to pyk using primer pyk1 (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk...
- 12
- 616
- 0
Tài liệu Water Pollution Control - A Guide to the Use of Water Quality Management Principles ppt
... standards and regulations However, the standards must be achievable and the regulations enforceable Unrealistic standards and non-enforceable regulations may more harm than having no standards ... Environment Federation Water and Wastewater Treatment 4th Edition R Bardolet Water: Economics, Management and Demand M Kay, T Franks and L Smith Water Policy P Howsam and R Carter Water Quality Assessments ... of Australia, Brazil, Canada, India, Tanzania, the United States and the World Health Organization (WHO) These sets of data were harmonised and used to generate the Interim National Water Quality...
- 459
- 4,872
- 0
Water Pollution Control - A Guide to the Use of Water Quality Management Principles ppt
... Environment Federation Water and Wastewater Treatment 4th Edition R Bardolet Water: Economics, Management and Demand M Kay, T Franks and L Smith Water Policy P Howsam and R Carter Water Quality Assessments ... Novak, A Moffat, C Nalluri and R Naryanan International River Water Quality G Best, T Bogacka and E Neimircyz Standard Methods for the Examination of Water and Wastewater 19th Edition Water Environment ... Inland Water Management and Waste Water Treatment (RIZA), Ministry of Transport, Public Works and Water Management, Lelystad, The Netherlands (Chapter 9) Guy J.F.R Alaerts, The World Bank, Washington,...
- 14
- 721
- 0
Báo cáo khoa học: "Combining a Statistical Language Model with Logistic Regression to Predict the Lexical and Syntactic Difficulty of Texts for FFL" potx
... Eskenazi 2007 Combining lexical and grammatical features to improve readability measures for first and second language texts In Proceedings of NAACL HLT, pages 460–467 P.-N Tan, M Steinbach, and ... correlation coefficient, prediction accuracy as defined by Tan et al (2005), and adjacent accuracy Adjacent accuracy is defined by Heilman et al (2008) as “the proportion of predictions that were within ... of standardisation and their levels have been clarified It is thus feasible to gather a large number of documents already labelled in terms of the CEFR scale by experts with an educational background...
- 9
- 514
- 0
WITH BRITISH GUNS IN ITALY A TRIBUTE TO ITALIAN ACHIEVEMENT pdf
... Headquarters of an Italian Seaplane Squadron The islands are thickly clothed with tamarisks and pollarded acacias and stone pines, and are reputed to be somewhat malarial There is a long beach ... hours in a gondola on the Grand Canal and up and down the Rii, filled with a dreamy amazement at the superb harmonies of form and colour of things both far away and close at hand And even as seen ... sun, and at midday an old woman sets up a stall here and sells the newspapers of Rome and Milan, Bologna and Venetia In one corner of this Piazza is a restaurant, where one can play billiards and...
- 188
- 375
- 0
HYGIENIC PHYSIOLOGY WITH SPECIAL REFERENCE TO THE USE OF ALCOHOLIC DRINKS AND NARCOTICS BEING A REVISED EDITION OF THE FOURTEEN WEEKS IN HUMAN PHYSIOLOGY ppt
... respiration, circulation, and the nervous system Leidy's "Human Anatomy," and Sappey's "Traité d'Anatomie" have been followed on all anatomical questions, and have furnished many beautiful drawings Huxley's ... etc., and, when practicable, their mode of treatment A pupil may thus learn, for example, the cause and cure of "a cold," the management of a wound, or the nature of an inflammation The Practical ... Bain's "Mind and Body"; Pettigrew's "Animal Locomotion"; Carpenter's "Human Physiology," and "Mental Physiology"; Wilder and Gage's "Anatomy"; Jarvis's "Physiology and Laws of Health." Hargreaves's...
- 532
- 562
- 0
ELDERLY SERVICES IN HEALTH CENTERS: A Guide to Address Unique Challenges of Caring for Elderly People with Disabilities, Frailty, and Other Special Needs pot
... urban areas and rural areas served by health centers and increasing numbers will be minorities such as African Americans, Latinos and AsianAmericans • Many will be adult patients of our health ... 41 states, as does TRICARE and many private insurance plans, HMO’s and other managed care organizations As with palliative care, hospice involves a team-oriented approach Ideally primary care ... placement to remain in the community PACE is usually based in adult day health centers and operates as a small Medicare Advantage capitated managed care plan at risk for providing all Medicare...
- 105
- 526
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25