similarity a new probabilistically techniques based on principle of hal is call probabilistic hyperspace analogue to language 33
Báo cáo khoa học: "A New Statistical Parser Based on Bigram Lexical Dependencies" potx
... accuracy as the beam is narrowed DARPA Speech and Natural Language Workshop T Briscoe and J Carroll 1993 Generalized LR Parsing of Natural Language (Corpora) with Unification -Based Grammars Computational ... three tokens of 'of' : E x a m p l e Shaw, based in Dalton, Ga., has annual sales of about $1.18 billion, and has economies o f scale and lower raw-material costs that are expected to boost the profitability ... that lexical information is crucial to attachment decisions, so it is natural to condition on the words and tags Let 1) be the vocabulary of all words seen in training data, T be the set of all...
- 8
- 320
- 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA ... AtxBrcb (R) AtxACFc (F) AtxACrcc (R) AmlFd (F) Amlrcd (R) CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA ... (110) GACCGgtaag/tccagCTGCT CTGTGgtgag/tgcagGAGGC (110) AGGCGgtgag/tccagTTGAA GACCGgtaag/tccagCTGCT GTGCGgtgag/tgtagGAGAC (110) AGGCGgtgag/tttagTTGAG GACCGgtaag/tccagCTGCT CTGCGgtgag/tgcagGAAAA (110)...
- 10
- 451
- 0
Tài liệu Báo cáo khoa học: "Event-based Hyperspace Analogue to Language for Query Expansion" ppt
... sources are the same as used to produce HAL, eHAL-1 and eHAL-2 respectively; Conclusions The application of original HAL to query expansion attempted to incorporate statistical word association information, ... construction of HAL from events (eHAL-1), and treating events as constraints on HAL construction from the corpus (eHAL-2) Evaluation will compare results using original HAL, eHAL1 and eHAL-2 with a widely ... Methods in Natural Language Processing and Computational Natural Language Learning, pp 12–21 Deerwester S., Dumais S., Furnas G., Landauer T and Harshman R Indexing by latent semantic analysis 1990...
- 6
- 478
- 0
Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx
... 2.4.1.19 AAP31242 AAB65420 CAA55023 CAA48401 AAG31622 BAB91217 CAA33763 AAA22298 P31835 BAA14289 AAA22308 ALBSX1 AAA22310 AAA22309 CAA46901 BAA31539 AAA22239 CAA01436 Z34466 BAA02380 CAA41770 AAD00555 ... emersonii Aspergillus awamori Aspergillus niger T21 Neurospora crassa AAB02927 AAT58037 BAA0 0331 AAB59296 AAB20818 BAA01254 L15383 BAA08436 CAA47945 AAA 3338 6 AAF75523 AAE15056 AAR61398 BAD06004 AAP04499 ... a- amylase amyCrysp a- amylase amyStrgr a- amylase amyStrlm a- amylase amyStrli1 a- amylase amyStrli2 a- amylase amyStrvi a- amylase amyThncu a- amylase amy_Aspaw a- amylase CBM20 (Purple of Fig.2) atrActsp...
- 17
- 476
- 0
Báo cáo khoa học: "A Novel Discourse Parser Based on Support Vector Machine Classification" docx
... fully annotated in a matter of minutes This opens the way to many novel applications in real-time natural language processing and generation, such as the RST -based transformation of monological ... structure and labeling of the RST tree produced by our algorithm to that obtained through manual annotation (our gold standard) Standard performance indicators for such a task are precision, recall and ... this paper, we have shown that it is possible to build an accurate automatic text-level discourse parser based on supervised machine-learning algorithms, using a feature-driven approach and a...
- 9
- 390
- 0
Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc
... mice To accomplish this goal, we repeatedly passaged the liver homogenates of MARV-infected scid mice and then Mouse adaptation The general approach to adapt MARV to mice was based on virus passage ... (BALB/c background) mice to avoid usage of suckling mice to develop a lethal mouseadapted Marburg virus The goal was to isolate the viral population that was capable of migrating to target tissues/ ... Care and Use of Laboratory Animals, National Research Council, 1996 The facility where this research was conducted is fully accredited by the Association for Assessment and Accreditation of Laboratory...
- 13
- 456
- 0
Báo cáo hóa học: " A biofeedback cycling training to improve locomotion: a case series study based on gait pattern classification of 153 chronic stroke patients" pdf
... MG, Balasubramanian CK, Behrman AL, Kautz SA: Validation of a speed -based classification system using quantitative measures of walking performance poststroke Neurorehabilitation and Neural Repair ... Hospital, Como, Italy Authors’ contributions SF participated to study design, data collection and analysis, and manuscript writing; EA participated to study design, data collection and analysis, and ... tasks are cyclical, require reciprocal flexion and extension movements of hip, knee, and ankle, and have an alternating activation of agonist/antagonist muscles in a well-timed and coordinated manner...
- 13
- 443
- 0
Báo cáo hóa học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" docx
... mice To accomplish this goal, we repeatedly passaged the liver homogenates of MARV-infected scid mice and then Mouse adaptation The general approach to adapt MARV to mice was based on virus passage ... (BALB/c background) mice to avoid usage of suckling mice to develop a lethal mouseadapted Marburg virus The goal was to isolate the viral population that was capable of migrating to target tissues/ ... Care and Use of Laboratory Animals, National Research Council, 1996 The facility where this research was conducted is fully accredited by the Association for Assessment and Accreditation of Laboratory...
- 13
- 431
- 0
Báo cáo hóa học: " A human motion model based on maps for navigation systems" pptx
... where a large conference hall is close to more constraining rooms and corridors Multimodal situations arise when a person walks past a door at an angle and a certain fraction of the particles walk ... function for PF -based positioning estimators that takes consideration of the heading distribution at each location and which is based on known maps The principle is similar to the so-called movement ... calculation of one human step based on the inertial measurements and is effectively a down-sampling from the IMU data rate to the rate of the upper filter Its output is a Gaussian distribution...
- 14
- 488
- 0
Báo cáo hóa học: "Research Article Unequal Error Protection Techniques Based on Wyner-Ziv Coding" doc
... congestion [24] A better way would be to reduce the data rate allocated to the primary video data transmission slightly and correspondingly increase the data rate allocated to the transmission of parity ... encoder consisted of a discrete cosine transform, a scalar quantizer and an irregular repeat accumulate code as the Slepian-Wolf coder Our approach to unequal error protection is also based on Wyner-Ziv ... will exacerbate network congestion [24] Instead, the total transmission data rate should be kept constant, which means that when the packet loss rate increases, the primary data transmission rate...
- 13
- 417
- 0
Báo cáo hóa học: " Research Article A Skin Detection Approach Based on Color Distance Map" doc
... the standard deviation, σ, of the portion of histogram at the right side of SSC We then generated ideal data for a Gaussian distribution having the mean at SSC and standard deviationσ and plotted ... in any color space Though the algorithm mainly operates on a grayscale image (DM), the processing is actually done based on color information The scalar distance map contains the information of ... USA, January 2006 M.-H Yang and N Ahuja, “Gaussian mixture model for human skin color and its applications in image and video databases,” in Storage and Retrieval for Image and Video Databases...
- 10
- 227
- 0
Báo cáo hóa học: "Research Article A Color Topographic Map Based on the Dichromatic Reflectance Model" doc
... (http://r0k.us/graphics/kodak/ the image size is reduced by a factor of two) and the University of Washington (http://www.cs.washington.edu/research/imagedatabase/ groundtruth/ tars.for.download) databases (Arborgreens, ... various kinds of materials and for several computer vision applications It states that [1] J Serra, Image Analysis and Mathematical Morphology, Academic Press, Orlando, Fla, USA, 1983 [2] V Caselles, ... evolution of the local maxima along the color lines, as well as from better characterizing the histogram-clusters REFERENCES CONCLUSION The topographic map is a compact and complete representation of...
- 14
- 343
- 0
Báo cáo hóa học: " Research Article A Suboptimal PTS Algorithm Based on Particle Swarm Optimization Technique for PAPR Reduction in OFDM Systems" potx
... computational complexity,” IEEE Transactions on Broadcasting, vol 52, no 1, pp 83–86, 2006 [14] A D S Jayalath and C Tellambura, “Adaptive PTS approach for reduce of peak -to- average power ratio of OFDM ... flowchart areallocated to the same subblock The last one is called random partitioning method in which the input symbol sequence is partitioned randomly The random partitioning is known as to have ... 0.1%, the acceleration factors c1 = 0.5 and c2 = 0.5, the PAPR is 8.3 dB, and acceleration factors c1 = and c2 = 2, the PAPR is 6.8 dB By these two examples of the acceleration factors c1 and c2...
- 8
- 406
- 0
Báo cáo hóa học: " A New Image Analysis Based Method for Measuring Electrospun Nanofiber Diameter" pptx
... measurement Automating the fiber diameter measurement and eliminating the use of the human operator is a natural solution to this problem Image Analysis An image analysis based method was proposed ... from the values of the distance map at any pixel location on the skeleton However, the occurrence of a broken skeleton at intersection points is a main challenging area within the use of this method ... most important features of simulation is that it allows several structural characteristics such as fiber diameter and orientation distribution and web density to be taken into consideration Since...
- 4
- 296
- 0
Báo cáo hóa học: " Research Article A Fixed Point Theorem Based on Miranda Uwe Sch¨ fer a" doc
... Bollettino dell’Unione Matematica Italiana, vol 3, pp 5–7, 1940 [2] M N Vrahatis, A short proof and a generalization of Miranda’s existence theorem,” Proceedings of the American Mathematical Society, ... theorem of Newton-Kantorovich,” Numerical Functional Analysis and Optimization, vol 23, no 3-4, pp 333 –357, 2002 [5] G Alefeld, A Frommer, G Heindl, and J Mayer, On the existence theorems of Kantorovich, ... Kantorovich, Miranda and Borsuk,” Electronic Transactions on Numerical Analysis, vol 17, pp 102–111, 2004 [6] N H Pavel, “Theorems of Brouwer and Miranda in terms of Bouligand-Nagumo fields,” Analele Stiintifice...
- 5
- 225
- 0
Báo cáo hóa học: " A New Image Analysis Based Method for Measuring Electrospun Nanofiber Diameter" ppt
... measurement Automating the fiber diameter measurement and eliminating the use of the human operator is a natural solution to this problem Image Analysis An image analysis based method was proposed ... from the values of the distance map at any pixel location on the skeleton However, the occurrence of a broken skeleton at intersection points is a main challenging area within the use of this method ... most important features of simulation is that it allows several structural characteristics such as fiber diameter and orientation distribution and web density to be taken into consideration Since...
- 4
- 330
- 0
Báo cáo hóa học: " Research Article A Fixed Point Theorem Based on Miranda Uwe Sch¨ fer a" docx
... Bollettino dell’Unione Matematica Italiana, vol 3, pp 5–7, 1940 [2] M N Vrahatis, A short proof and a generalization of Miranda’s existence theorem,” Proceedings of the American Mathematical Society, ... theorem of Newton-Kantorovich,” Numerical Functional Analysis and Optimization, vol 23, no 3-4, pp 333 –357, 2002 [5] G Alefeld, A Frommer, G Heindl, and J Mayer, On the existence theorems of Kantorovich, ... Kantorovich, Miranda and Borsuk,” Electronic Transactions on Numerical Analysis, vol 17, pp 102–111, 2004 [6] N H Pavel, “Theorems of Brouwer and Miranda in terms of Bouligand-Nagumo fields,” Analele Stiintifice...
- 5
- 242
- 0
Báo cáo hóa học: " Research Article Multimodality Inferring of Human Cognitive States Based on Integration of Neuro-Fuzzy Network and Information Fusion Techniques" pot
... Murai, Y Hayashi, and N Wakabayashi, “Analysis of heart rate variability of navigator at in/from ports by wavelet transform,” in Proceedings of the IEEE Pacific Rim Conference on Communications, ... center of the simulated freeway At the same time, EEG and ECG signals of each participant are measured at the sampling rate of 250 HZ, and his/her dynamical facial image is obtained at the sampling ... 21–28, 1995 [43] J P Mart´nez, R Almeida, S Olmos, A P Rocha, and P Laı guna, A wavelet -based ECG delineator evaluation on standard databases,” IEEE Transactions on Biomedical Engineering, vol...
- 14
- 303
- 0
Báo cáo hóa học: " Performance Evaluation of Indoor Localization Techniques Based on RF Power Measurements from Active or Passive Devices" pptx
... estimation algorithm is based on the RF map of the area The RF map is a database containing the power Damiano De Luca et al j = arg i=1, ,Npoints w − Wi , (4) where · is the quadratic vector norm ... the hardware inside the terminal to be located In this paper, we present a statistical characterization of power measurement errors based on experimental data and we show that these inaccuracies ... “Tor Vergata,” Italy He is the author of several scientific publications and the coauthor of a book on radar systems (in Italian) His main interests are in statistical signal processing, estimation...
- 11
- 314
- 0
Báo cáo hóa học: " Autonomous Positioning Techniques Based on ´ Cramer-Rao Lower Bound Analysis" pot
... pair-wise equal pTOA noise variances, have a variance in the y-direction corresponding to half of the pTOA measurement variance σk1 ,k2 , translated diag(0, σ /2) We finally into distance, that is, Ck,k2 ... zero-mean Gaussian distribution with a variance of s2 Based on the node coordinates and the clockoffsets, true pTOA distance measurements were calculated and zero-mean Gaussian noise with a standard ... CRB calculated in estimated coordinates to estimate the accuracy in a position estimate based on TDOA measurements, as a rule of thumb, yields accurate estimates as long as the true variance is...
- 10
- 323
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25