shape based detection of cortex variability for more accurate discrimination between autistic and normal brains
Báo cáo khoa học: "Unsupervised Lexicon-Based Resolution of Unknown Words for Full Morphological Analysis" doc
... (Dermatas and Kokkinakis, 1995)) In previous work, we report disambiguation rates of 89% for full morphological disambiguation (using an unsupervised EM-HMM model) and 92.5% for part of speech and ... classification of a sample of 10K unknown token types out of the 200K unknown types identified in the corpus; (3) the number of unknown analyses, based on an annotated corpus of 200K tokens, and their ... Chinese and Japanese We also could not rely on the existence of an annotated corpus of segmented word forms Habash and Rambow (2006) used the root+pattern+features representation of Arabic tokens for...
- 9
- 273
- 0
Báo cáo hóa học: " Research Article A WiMAX-Based Implementation of Network MIMO for Indoor Wireless Systems" pptx
... latter is potentially more accurate, but requires the estimation and tracking of the time-frequency covariance structure of the channel, and is therefore potentially less robust For the indoor system ... between users becomes more significant relative to receiver thermal noise, and therefore the mitigation of such interference through network MIMO becomes more beneficial For system parameters of ... single set of beamforming weights for the users) For the indoor channel of interest to us, a reasonable choice of the tile size is 18 contiguous subcarriers (i.e., frequency “bin”) by 24 OFDM symbols...
- 11
- 398
- 0
Báo cáo hóa học: " Stochastic Feature Transformation with Divergence-Based Out-of-Handset Rejection for Robust Speaker Verification" pot
... cb3 and row cb4 are large Therefore, in the first part of the experiment, we use handsets cb3 and cb4 as the unseen handsets, and the other eight handsets as the seen handsets Seen and unseen handsets ... because the characteristics of handset cb3 are similar to those of the seen handset cb4, while those of handset el2 are similar to those of the seen handsets el3 and pt1 Therefore, when utterances ... there were 365 and 316 rejections out of 450 test utterances for the two unseen handsets (cb3 and cb4), respectively As a result of these rejections, the EERs of handsets cb3 and cb4 were reduced...
- 14
- 235
- 0
Báo cáo khoa học: "PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases" doc
... lonaporposi htiw detatipicerp saw AND )1 : 42( lohocla lymaosi :mroforolhc dna )1 : 1( mroforolhc :lonehp htiw noitcartxe yb deifirup saw AND Co56 ta nim 03 rof detabucni dna )lCaN M 7.0 ni edimorb ... :drawrof CGAAATCAAGCAGTTCCGAACGCA :esrever TTGGCATAGTGGTAGTTAGC :drawrof TACAGCAATTTGGACCAC :esrever AAGGAGAAAACCACGAAC :drawrof CTCCTTCTGTTGTTGTTCGG :esrever GCGTCGTAAACGTCGTCCAC :drawrof CGTAGCTTGTTAGCCTTCG ... ,hcirdlA amgiS( esaremylop AND qaT U1 dna ,)aidnI ,ieneG erolagnaB( sremirp eht fo hcae fo lomp 01 ,sPTNd ruof eht fo Mµ 002 ,2lCgM Mm 52 ,)ASU ,hcirdlA amgiS( reffub RCP × 01 ,AND etalpmet lµ dedulcni...
- 4
- 138
- 0
Báo cáo y học: "Segmentation-based detection of allelic imbalance and loss-of-heterozygosity in cancer cells using whole genome SNP arrays" ppsx
... (HMMs) for which several different software packages exist, for example, dChipSNP [10], CNAT [11], PennCNV [12] and QuantiSNP [13] Unfortunately, several of the existing software packages for LOH detection ... describe a segmentation -based strategy for detection of LOH and allelic imbalances from WGG array data The strategy allows for a large proportion of normal cell components and/ or tumor cell clone ... threshold as proposed for the normalization of copy number data [19] Furthermore, the segmented value of an allelic imbalance can be used for accurate estimation of the proportion of affected cells...
- 18
- 284
- 0
Competence Based Assessment of Listening Skill for ESL Students
... role of supervisors and guide leaners in learning process The instruments for measurement are items standardized and designed by experts as TOEIC test form that fits outcomes standards for technical ... solution and prompt support for each student to achieve higher knowledge and skill Graph Map of distribution between students competence and items difficulty Graph Map of distribution between ... pay more time and effort on improving vocabulary, the skill of pronunciation and brainstorming what might happen in the text, and other techniques, etc The Graph below shows the latent traits of...
- 10
- 384
- 1
Development of chitosan based blend hollow fiber membranes for adsorptive separation in environmental engineering and bioengineering applications
... polymeric and inorganic materials can be used for MF membranes [12] Ultrafiltration (UF) covers the region between MF and NF and is used to remove particles and colloids in the size range of 1-100nm For ... impression on me and has helped me out immensely by keeping me and my research focused and on track I owe him lots of gratitude for having shown me the ways of scientific research Besides of being an ... literature and characteristics of the blend membranes or films 41 Table 3.1 Dope compositions and other information for the Pure CA hollow fibers and CS/CA blend hollow fibers 0.5-26.5-OH and...
- 227
- 962
- 0
Integrating DNA sequence features for more accurate prediction of replication origins in some double stranded DNA viral genomes
... gratitude and appreciation to Professor Bai Zhidong and Professor Chen Zehua for his continuous encouragement and support My gratitude also goes to the National University of Singapore for awarding ... determines the makeup of all living cells and many viruses DNA is capable of self-replication and synthesis of RNA The long-term storage of information is the main function of DNA molecules The ... feel a deep sense of gratitude for my husband Yu Dingyi, for his love, thoughtfulness and cheering me on CONTENTS iii Contents Acknowledgements Summary List of Tables List of Figures Introduction...
- 144
- 183
- 0
Tài liệu The Development of the Feeling for Nature in the Middle Ages and Modern Times doc
... melancholy attitude of the Fathers of the Church, Basil and Gregory, or for Augustine's deep faith and devout admiration of the works of creation: even the tone of Ausonius and Fortunatus, in their ... western world The distance between the works of the Greek artists and poets between Homer, Sophocles, and Phidias on the one hand, and the Alexandrian Theocritus and Kallimachos and the Pergamos sculptures ... been absorbed and freed from all demoniac influence, but peopled by the charming forms of the old mythic poems, and made for the joy and profit of men, in the widest and naivest sense of the words...
- 194
- 633
- 0
Báo cáo toán học: " Nonexistence of nontrivial solutions for the p(x)-Laplacian equations and systems in unbounded domains of Rn" docx
... Nonexistence of nontrivial solutions for the p (x) −Laplacian equations and systems in unbounded domains of Rn AKROUT Kamel∗1 Department of mathematics and informatics.Tebessa university ... rest of the proof is similar to the that of lemma Principal Result 1,p(x) theorem 3.1 If u ∈ W0 (Ω) ∩ L∞ Ω be a solution of the problem (1.1) − (1.2), Ω is star shaped and that a, H, f and F ... Therefore, the problem admits only the null solution Proof Similar to the proof of theorem 1,pk (x) theorem 3.3 If uk ∈ W0 (Ω) ∩ L∞ Ω solution of the system (1.6) − (1.7), Ω is a star shaped and...
- 12
- 308
- 0
Báo cáo khoa học: "Interpreting the variations in xylem sap flux density within the trunk of maritime pine (Pinus pinaster Ait.): application of a model for calculating water flows at tree and stand levels" pdf
... et al [37] and Milne improving the accuracy of the estimation of water flux at tree and stand levels [25] derived values of stem resistance and capacitance from field measurements of water potential, ... fitted between Jr and (t) i according to equation (6) and then extract the value of C using the value of R cali i culated previously For the capacitance of the needle compartment, we used a value of ... description of the network of resistances and capacitances which characterise the pathway of water between the soil and the atmosphere [18, 26] In order to this, we need a scheme for quantitatively...
- 18
- 406
- 0
Rapid detection of epidermal growth factor receptor mutations with multiplex PCR and primer extension in lung cancer pdf
... terms of the amount of work and time required With this method, -216 promoter region and exons 18-21 of the EGFR gene were amplified with multiplex PCR in a single tube and the detection of mutations ... promoter region and exons 18-21 of the EGFR genes (Table 1) PCR amplification of 0.2 μg DNA was performed with a denaturing step at 94°C for min, then 30 sec at 94°C, at 58°C, and at 72°C for 35 cycles, ... Journal of Biomedical Science 2010, 17:37 http://www.jbiomedsci.com/content/17/1/37 Page of Figure Detection of wild-type and mutant EGFR by primer extension analysis NSCLC DNA samples of wild-type...
- 6
- 234
- 0
báo cáo khoa học: "Implementing health research through academic and clinical partnerships: a realistic evaluation of the Collaborations for Leadership in Applied Health Research and Care (CLAHRC)" pot
... provide information for learning, not for judgement The purpose of the evaluation is formative, focusing on processes and a range of potential and actual impacts from implementation and use of knowledge ... ensuring burden and disruption are minimised, and this has been formalised in the memorandum of understanding (see additional file 5) We will therefore negotiate and agree the practicalities of data ... types of knowledge that are given attention and valued’ and ‘The impact of translation and implementation of knowledge in and through CLAHRCs will be dependent upon the adoption and use of appropriate...
- 12
- 389
- 0
Báo cáo y học: " Use of different but overlapping determinants in a retrovirus receptor accounts for non-reciprocal interference between xenotropic and polytropic murine leukemia viruses" ppt
... comparison of the Env SU domains of AKR6 X-MLV, 1E P-MLV, and prototypic X-MLV and P-MLV Figure Amino acid sequence comparison of the Env SU domains of AKR6 X-MLV, 1E P-MLV, and prototypic X-MLV and ... or more of those of the P-MLVs, or both Cyan boxes indicate amino acids that are identical among the PMLVs and similar to those of the X-MLVs, identical among the X-MLVs and similar to those of ... Fluorescence Figure 1E SU Binding and interference properties of cloned AKR6 SU and Binding and interference properties of cloned AKR6 SU and 1E SU (A) LAPSN(AKR6env) and LAPSN(10A1env) vector titers...
- 12
- 227
- 0
Báo cáo sinh học: "Quantitative estimation of genetic risk for atypical scrapie in French sheep and potential consequences of the current breeding programme for resistance to scrapie on the risk of atypical scrapie" pptx
... in its design and coordination AF and CM performed the strategy of the selection of animals and carried out the statistical analysis JNA performed the scrapie status confirmation and the strain ... Regulation (EC) No 999/2001 of the European Parliament and of the Council of 22 May 2001 laying down rules for the prevention, control and eradication of certain transmissible spongiform encephalopathies ... poor proxy for age [28] but was the only information available This led to exclude some animals for which information was missing (two cases of CS and nine controls) Multivariate analysis For each...
- 7
- 300
- 0
Application of preferential crystallization for racemic compound integrating thermodynamics, kinetics and optimization 4
... calculated for mandelic acid and ketoprofen The Laplace transform analysis (s plane method) was used for the (S)- and (RS)-mandelic acid kinetics calculation The methods of moments analysis and Laplace ... comparable with those of Laplace transform analysis for ketoprofen The enantiomer and racemate of mandelic acid and ketoprofen show different characteristics in crystal nucleation and growth 118 Among ... 5.4 Results and discussion 5.4.1 Crystal nucleation and growth kinetics for the (S)-MA and (RS)-MA 5.4.1.1 Crystal suspension density and supersaturation The method of Laplace transform analysis...
- 27
- 198
- 0
Application of preferential crystallization for racemic compound integrating thermodynamics, kinetics and optimization 5
... were in the form of mixture of (RS)-MA and (S)-MA This may suggest that there is no selectivity of crystal growth of the pure enantiomer and racemate for a racemic compound when both (S) and (RS) ... Progression of direct crystallization of mandelic acid 129 Table 6.1 The optical purity of the final crystal products with different cooling degree for mandelic acid Optical purity of Optical purity of ... selectivity of crystal growth and nucleation of the pure enantiomer and racemate for a racemic compound The relative solubility and critical supersaturation control of the pure enantiomer and racemate...
- 27
- 285
- 0
Application of preferential crystallization for racemic compound integrating thermodynamics, kinetics and optimization 6
... determined as 70% of (S)-MA for mandelic acid and 91.6% of (S)-Kp for ketoprofen In chapter 4, the thermodynamic properties in solution were studied for the mandelic acid and ketoprofen using the ... calculation and binary phase diagram The spectra of FTIR, Raman and PXRD were different between the pure enantiomer and racemate for the mandelic acid and ketoprofen, which indicates that the mandelic ... 0.027g/ml for mandelic acid It suggests that it is more difficult to control the supercooling for the preferential crystallization for ketoprofen and the nucleation of enantiomer and racemate of ketoprofen...
- 47
- 356
- 0
Application of preferential crystallization for racemic compound integrating thermodynamics, kinetics and optimization 1
... as mandelic acid (MA) for the more favorable case and ketoprofen (Kp) for the unfavorable case, respectively (R)-mandelic acid (S)-mandelic acid Fig 2.7 Chemical structure of (R)- and (S)- mandelic ... transform analysis and moment analysis were used for deriving the crystal growth rate and nucleation rate in the batch crystallization process for enantiomer and racemate of mandelic acid and ... method for this process Amanullah and Mazzotti (2006) presented an analysis of a hybrid process consisting of SMB chromatography and crystallization and studied its performance for the separation of...
- 54
- 296
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25