... basis Primary Care Case Management Primary care case management (PCCM) is a form of managed care that can be used to create and sustain a medical home model Participat ing families choose a ... referrals and linkages? (See Section for additional questions) • Are case managers available to assist families that face barriers? • Are case management supports available directly to teens, particularly ... activity; 2) at the State’s medical assistance matching rate for medical assistance (also known as targeted) case management; and 3) at 75 percent for case man agement performed by skilled medical personnel...
... experts Make sure to consult and involve local stakeholders Make the information available to the public • Historic loss data: Prepare and maintain an updated database of disaster losses from past ... has put programmes in place to build capacity, assess hazards and vulnerability, and implement a city-wide action plan that contains structural and planning measures for restoring natural drainage, ... (UCLG); Bernadia Irawati Tjandradewi (CITYNET); Dan Lewis and Ana Moreno (UNHABITAT); Rajib Shaw (Kyoto University - Asia Urban Risk Reduction Task Force); Janet Edwards (Swedish National Platform);...
... not always find its way into schools An example: people have believed for at least half a century that a foreign language is best learned at a young age Yet in schools in the USA and Australia a ... but there has been a great deal of debate asto what IQ really measures Sociologists argue that IQ measures aspects of socialization and that cultural bias in IQ tests negates their use across cultures ... postulated, and it was this high motivation that enabled them to overcome disadvantages such as low social status and their parents lack of an English language education And this motivation was great...
... epinephrine was associated with a significant increase in lactate without any change in L/P ratio [12] Moreover, epinephrine use was not associated with a decrease in tissue ATP [12], demonstrating that ... increase in MAP with an increase in cardiac index [6] Using epinephrine asa first line agent, Moran et al [7] reported a linear relationship between epinephrine dosage and heart rate, MAP, cardiac ... epinephrine, when associated with dobutamine, decreased hepatosplanchnic blood flow, increased the SVO2-SHO2 gradient and increased arterial lactate and hepatic lactate consumption without any net effect...
... separated and P was far away from The assumption of homogeneity of variances was to ensure a global maximum of the likelihood, but perhaps at the expense of realism, as one would expect the variances ... distribution An illustration is in [36], where different trajectories of SCS are reported for mastitis-infected and healthy cows A randomly drawn SCS at any stage of lactation can pertain to either a healthy ... variances, then θ has elements: P, the means and the variances In general, the y may be either scalar or vector valued, or may be discrete as in [5, 28] Methods for inferring parameters are maximum...
... Key Stage SATs (standard assessment tests) when he was seven and was assessed in all areas as working towards level 13, which is well below average Now in school less than a year later, his maths ... he was in Year He had an hour a day initially but this has now been increased to about two and a half hours Please see Chapter for further information about the statementing procedure W hat are ... physiotherapist and the occupational therapist may be asked to assess children individually or as part of a multidisciplinary assessment – they may well carry out a joint assessment Referrals may be made...
... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a and Hsp90b, as well as the native yeast Hsp90s, were all capable of activating GR in these strains ... tryptophan Automated measurement of the b-galactosidase activity due to basal and stress-induced expression of the interaction-responsive, GAL7 promoterregulated LacZ gene of PJ69-4 was as previously...
... Internet, and other sources Data analysis: Qualitative analysis was done for secondary data and primary data collected from interviews Quantitative analysis was done for primary data collected ... is still very weak, although the Director has paid attention to it The Company has an unclear management information system and lack of retailers and consumers database to manage the distribution ... consumers’ awareness about auto-voltage stabilizer brand name and their evaluation towards LiOA brand in details Its objectives are: • To evaluate the brand awareness of consumers towards AVS products...
... pGEMT–5¢HumanCPT1B asa template in a PCR reaction with primers DH673 (5¢-AGCTGAATTC ATGGCGGAAGCTCACCAG-3¢) and DH803 (5¢-TCCA CCCATGGTAGCAGAGAAGCAGCTTAAGGGTTTGG CGGA-3¢) The PCR reaction yielded a 422-bp ... was used asa template to introduce a mutation using the QuickChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) The primers were DH869 (5¢-GGAGTTGCTGGCC AAAGAGTTCCAGGACAAGACTGCCC-3¢) ... carnitine palmitoyltransferase I Genomics 80, 433–442 Wolfgang MJ, Kurama T, Dai Y, Suwa A, Asaumi M, Matsumoto S, Cha SH, Shimokawa T & Lane MD (2006) The brain-specific carnitine palmitoyltransferase1c...
... substrate affinity and phosphatase activity (as shown by Table Summary of kinetic parameters of CaNa and CaNb phosphatase activities toward three substrates The Km and Vmax values, CaP IC50 values, ... shown are the averages ± SD from three assays in triplicate for each CaN heterodimer CaNa, d; CaNb, s CaM dissociation constants for both CaNa and CaNb Fast and slow rates of s)1 and 0.4 s)1, and ... confirm that CnAa and CnAb proteins are expressed by the appropriate recombinant CnAa and CnAb baculoviruses (Fig 1B,C) Kinetic assays of CaNa and CaNb phosphatase activity Fig SDS/PAGE and Western...
... context for two main reasons First, many autonomy experts suggest it as an option to approach the problem According to Little [15], students are not automatically autonomous in the formal classroom ... procedure for SRSD is adapted from the literature on SRSD (e.g Graham and Harris [19]; Mason, Harris and Graham [18]; Harris, Graham and Mason [20]; Chalk, Hagan-Burke and Burke [21]) Information ... This way, the students will learn and apply the strategies in the real writing task and the chance that they are going to memorize, generalize, and maintain them is increased A plan for evaluating...
... toas necessary The testing session lasted about 15 and participants were debriefed following the experiment Results AÂÂ repeated measure analysis of variance (ANOVA) with 71 participants was ... stimuli and LBR were treated as within subjects factors, and participant gender was treated asa between subjects factor The Greenhouse–Geisser correction was applied to results involving LBR, as ... the arms was altered accordingly The legs were measured as the distance between the bottom of the feet and top of the pelvic region (above the hips and below the waist) The body was measured as...
... sandy soil Ancillary measurements of sap flow rate were obtained by heat balance method (Sakuratani, 1981; Baker and van Bavel, 1987) installing three gauges (model SGA10, Dynagage, USA) Total ... the available energy as latent heat in the morning and gradually increase the release of sensible heat in the afternoon This has been shown to be due toa regular increase of surface resistance ... Quercus ilex L canopy It has been extensively studied as the largest residual patch of Mediterranean oak in northeastern Italy Average annual air temperature is 13.3 °C and total rainfall is 614 mm...
... BMI, mean disease duration, WOMAC R1377 Arthritis Research & Therapy Vol No Maheu et al Table Baseline characteristics of the 50 patients for whom radiographs were available Baseline characteristic ... were also very high for each observer for all three views, as shown in Table Both readers exhibited very good precision, as assessed using the ICC Reader was more accurate for all measures, as assessed ... was drawn on heavy-weight paper during initial radiography and was used to position the patient at each subsequent examination Radiation exposure for each patient was 0.7 mSv (milliSieverts) for...
... protein analysis The cartilage used for RNA quantification was diced and incubated with RNAlater (Qiagen Inc., Valencia, CA, USA) overnight at 4°C prior to storage Available online http://arthritis-research.com/content/8/5/R149 ... cartilage Ratio II collagen in OF and OA cartilage of aggrecan to type II collagen in the cartilage matrix of OA and OF femoral heads and comparison between areas (SP and IP) Aggrecan and type ... proteoglycan extraction and was quantified by Bradford method Separated maximum (SP) and minimum (IP) mechanical load areas were obtained from each femoral head The horizontal bar indicates the median,...
... of around 80 chromosomes separated into two classes: a few distinguishable macrochromosomes and amuch higher number of small microchromosomes, visualized as dots on metaphase preparations and ... and usually classified by decreasing size (17! Except for the Falconiformes and particularly the Accipitridae family which has no more than three to six microchromosome pairs (24!, the average number ... genetic maps For this purpose, a collection of large insert BAC (bacterial artificial chromosome) and PAC (bacteriophage PI artificial chromosome) clones [80] to be used as microchromosome tags for...
... [4,5] KRAS is an important molecule in the EGFR signaling pathway KRAS encodes a membrane-associated GTPase that is an early player in many signal transduction pathways KRAS acts asa molecular on/off ... KRAS MT has worse RR and TTP KRAS MT has worse RR KRAS MT has worse RR, TTP, and OS KRAS MT has worse RR, TTP, and OS KRAS WT has worse OS KRAS WT did not respond KRAS MT has worse RR Escalated ... to panitumumab In each case, KRAS MT was also associated with reduced TTP and OS The data reported by Benvenuti and colleagues [9] showed a two-fold increase in RR associated with KRAS WT status...
... HCD increased plasma SAA as seen by others [20], and plasma CD14 was induced (Figure 8A) L-alanine:2-oxoglutarate aminotransferase, ALT Although the consequences of the increases in SAA and CD14 ... Plasma cholesterol was measured with Infinity Cholesterol Reagents (Sigma-Aldrich, Inc., St Louis, MO) Plasma alanine:2-oxoglutarate aminotransferase (ALT), aspartate aminotransferase (AST) were ... mediators Ann N Y Acad Sci 1989, 557:310-5; discussion 315-6 Shimada H, Hasegawa N, Koh H, Tasaka S, Shimizu M, Yamada W, Nishimura T, Amakawa K, Kohno M, Sawafuji M, Nakamura K, Fujishima S, Yamaguchi...
... data Outcome was classed as “success” or “failure” based on the work of Quinn and Ward [27] and Cope and Ward [28] who used similar criteria for outcome measures in their study Success was based ... Historical, clinical and risk subscale as well as total HCR-20 score asa predictor of the outcome “failure” medium secure psychiatric care As far as we know this is the first international study ... adult female or child, robbery and arson, based on the criteria of Bailey and MacCulloch [22] Data analysis Data were analyzed using the Statistical Package for Social Sciences SPSS for Windows...
... just as likely to cause cancer as smoking cigarettes [20] These findings are in direct contrast to the general agreement among tobacco research and policy experts that ST use is far less hazardous ... ST and pharmaceutical nicotine in a regulatory, legal and social context further suggests that the potential of ST asa cessation aid has been under-realized Nicotine gum and the nicotine patch ... the American Cancer Society Great American Smokeout [25] In 1999 an estimated $200 million was spent on print and broadcast advertising for smoking cessation products [26] In contrast to the heavy...