sensitivity to infants cues as much a mandate for researchers as for parents
Collaboration and Action to Improve Child Health Systems: A Toolkit for State Leaders docx
... basis Primary Care Case Management Primary care case management (PCCM) is a form of managed care that can be used to create and sustain a medical home model Participat ing families choose a ... referrals and linkages? (See Section for additional questions) • Are case managers available to assist families that face barriers? • Are case management supports available directly to teens, particularly ... activity; 2) at the State’s medical assistance matching rate for medical assistance (also known as targeted) case management; and 3) at 75 percent for case man agement performed by skilled medical personnel...
- 52
- 417
- 0
How To Make Cities More Resilient A Handbook For Local Government Leaders doc
... experts Make sure to consult and involve local stakeholders Make the information available to the public • Historic loss data: Prepare and maintain an updated database of disaster losses from past ... has put programmes in place to build capacity, assess hazards and vulnerability, and implement a city-wide action plan that contains structural and planning measures for restoring natural drainage, ... (UCLG); Bernadia Irawati Tjandradewi (CITYNET); Dan Lewis and Ana Moreno (UNHABITAT); Rajib Shaw (Kyoto University - Asia Urban Risk Reduction Task Force); Janet Edwards (Swedish National Platform);...
- 100
- 492
- 0
HOW TO SUCCEED IN SCHOOL AND UNIVERSITY - A GUIDE FOR PARENTS AND STUDENTS pot
... not always find its way into schools An example: people have believed for at least half a century that a foreign language is best learned at a young age Yet in schools in the USA and Australia a ... but there has been a great deal of debate as to what IQ really measures Sociologists argue that IQ measures aspects of socialization and that cultural bias in IQ tests negates their use across cultures ... postulated, and it was this high motivation that enabled them to overcome disadvantages such as low social status and their parents lack of an English language education And this motivation was great...
- 55
- 402
- 0
Báo cáo khoa học: "Bench-to-bedside review: Is there a place for epinephrine in septic shock" pptx
... epinephrine was associated with a significant increase in lactate without any change in L/P ratio [12] Moreover, epinephrine use was not associated with a decrease in tissue ATP [12], demonstrating that ... increase in MAP with an increase in cardiac index [6] Using epinephrine as a first line agent, Moran et al [7] reported a linear relationship between epinephrine dosage and heart rate, MAP, cardiac ... epinephrine, when associated with dobutamine, decreased hepatosplanchnic blood flow, increased the SVO2-SHO2 gradient and increased arterial lactate and hepatic lactate consumption without any net effect...
- 5
- 278
- 0
Báo cáo sinh học: "Mixture model for inferring susceptibility to mastitis in dairy cattle: a procedure for likelihood-based inference" pdf
... separated and P was far away from The assumption of homogeneity of variances was to ensure a global maximum of the likelihood, but perhaps at the expense of realism, as one would expect the variances ... distribution An illustration is in [36], where different trajectories of SCS are reported for mastitis-infected and healthy cows A randomly drawn SCS at any stage of lactation can pertain to either a healthy ... variances, then θ has elements: P, the means and the variances In general, the y may be either scalar or vector valued, or may be discrete as in [5, 28] Methods for inferring parameters are maximum...
- 25
- 246
- 0
Understanding Dyspraxia A Guide for Parents and Teachers Second edition doc
... Key Stage SATs (standard assessment tests) when he was seven and was assessed in all areas as working towards level 13, which is well below average Now in school less than a year later, his maths ... he was in Year He had an hour a day initially but this has now been increased to about two and a half hours Please see Chapter for further information about the statementing procedure W hat are ... physiotherapist and the occupational therapist may be asked to assess children individually or as part of a multidisciplinary assessment – they may well carry out a joint assessment Referrals may be made...
- 142
- 471
- 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a and Hsp90b, as well as the native yeast Hsp90s, were all capable of activating GR in these strains ... tryptophan Automated measurement of the b-galactosidase activity due to basal and stress-induced expression of the interaction-responsive, GAL7 promoterregulated LacZ gene of PJ69-4 was as previously...
- 11
- 427
- 0
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY
... Internet, and other sources Data analysis: Qualitative analysis was done for secondary data and primary data collected from interviews Quantitative analysis was done for primary data collected ... is still very weak, although the Director has paid attention to it The Company has an unclear management information system and lack of retailers and consumers database to manage the distribution ... consumers’ awareness about auto-voltage stabilizer brand name and their evaluation towards LiOA brand in details Its objectives are: • To evaluate the brand awareness of consumers towards AVS products...
- 67
- 974
- 0
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx
... pGEMT–5¢HumanCPT1B as a template in a PCR reaction with primers DH673 (5¢-AGCTGAATTC ATGGCGGAAGCTCACCAG-3¢) and DH803 (5¢-TCCA CCCATGGTAGCAGAGAAGCAGCTTAAGGGTTTGG CGGA-3¢) The PCR reaction yielded a 422-bp ... was used as a template to introduce a mutation using the QuickChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) The primers were DH869 (5¢-GGAGTTGCTGGCC AAAGAGTTCCAGGACAAGACTGCCC-3¢) ... carnitine palmitoyltransferase I Genomics 80, 433–442 Wolfgang MJ, Kurama T, Dai Y, Suwa A, Asaumi M, Matsumoto S, Cha SH, Shimokawa T & Lane MD (2006) The brain-specific carnitine palmitoyltransferase1c...
- 9
- 550
- 0
Báo cáo Y học: Substrate selectivity and sensitivity to inhibition by FK506 and cyclosporin A of calcineurin heterodimers composed of the a or b catalytic subunit potx
... substrate affinity and phosphatase activity (as shown by Table Summary of kinetic parameters of CaNa and CaNb phosphatase activities toward three substrates The Km and Vmax values, CaP IC50 values, ... shown are the averages ± SD from three assays in triplicate for each CaN heterodimer CaNa, d; CaNb, s CaM dissociation constants for both CaNa and CaNb Fast and slow rates of s)1 and 0.4 s)1, and ... confirm that CnAa and CnAb proteins are expressed by the appropriate recombinant CnAa and CnAb baculoviruses (Fig 1B,C) Kinetic assays of CaNa and CaNb phosphatase activity Fig SDS/PAGE and Western...
- 9
- 473
- 0
Báo cáo " Self-regulated strategy development as a means to foster learner autonomy in a writing course " pdf
... context for two main reasons First, many autonomy experts suggest it as an option to approach the problem According to Little [15], students are not automatically autonomous in the formal classroom ... procedure for SRSD is adapted from the literature on SRSD (e.g Graham and Harris [19]; Mason, Harris and Graham [18]; Harris, Graham and Mason [20]; Chalk, Hagan-Burke and Burke [21]) Information ... This way, the students will learn and apply the strategies in the real writing task and the chance that they are going to memorize, generalize, and maintain them is increased A plan for evaluating...
- 8
- 518
- 4
The leg-to-body ratio as a human aesthetic criterion pdf
... to as necessary The testing session lasted about 15 and participants were debriefed following the experiment Results A Â Â repeated measure analysis of variance (ANOVA) with 71 participants was ... stimuli and LBR were treated as within subjects factors, and participant gender was treated as a between subjects factor The Greenhouse–Geisser correction was applied to results involving LBR, as ... the arms was altered accordingly The legs were measured as the distance between the bottom of the feet and top of the pelvic region (above the hips and below the waist) The body was measured as...
- 7
- 408
- 0
Báo cáo lâm nghiệp: "Micrometeorological assessment of sensitivity of canopy resistance to vapour pressure deficit in a Mediterranean oak forest * " potx
... sandy soil Ancillary measurements of sap flow rate were obtained by heat balance method (Sakuratani, 1981; Baker and van Bavel, 1987) installing three gauges (model SGA10, Dynagage, USA) Total ... the available energy as latent heat in the morning and gradually increase the release of sensible heat in the afternoon This has been shown to be due to a regular increase of surface resistance ... Quercus ilex L canopy It has been extensively studied as the largest residual patch of Mediterranean oak in northeastern Italy Average annual air temperature is 13.3 °C and total rainfall is 614 mm...
- 8
- 271
- 0
Báo cáo y học: "Reproducibility and sensitivity to change of various methods to measure joint space width in osteoarthritis of the hip: a double reading of three different radiographic views taken with a three-year interval" pot
... BMI, mean disease duration, WOMAC R1377 Arthritis Research & Therapy Vol No Maheu et al Table Baseline characteristics of the 50 patients for whom radiographs were available Baseline characteristic ... were also very high for each observer for all three views, as shown in Table Both readers exhibited very good precision, as assessed using the ICC Reader was more accurate for all measures, as assessed ... was drawn on heavy-weight paper during initial radiography and was used to position the patient at each subsequent examination Radiation exposure for each patient was 0.7 mSv (milliSieverts) for...
- 11
- 410
- 0
Báo cáo y học: "Decreased metalloproteinase production as a response to mechanical pressure in human cartilage: a mechanism for homeostatic regulatio" pps
... protein analysis The cartilage used for RNA quantification was diced and incubated with RNAlater (Qiagen Inc., Valencia, CA, USA) overnight at 4°C prior to storage Available online http://arthritis-research.com/content/8/5/R149 ... cartilage Ratio II collagen in OF and OA cartilage of aggrecan to type II collagen in the cartilage matrix of OA and OF femoral heads and comparison between areas (SP and IP) Aggrecan and type ... proteoglycan extraction and was quantified by Bradford method Separated maximum (SP) and minimum (IP) mechanical load areas were obtained from each femoral head The horizontal bar indicates the median,...
- 11
- 520
- 0
Báo cáo khoa hoc:" The chicken as a model to study microchromosomes in birds: a review" potx
... of around 80 chromosomes separated into two classes: a few distinguishable macrochromosomes and a much higher number of small microchromosomes, visualized as dots on metaphase preparations and ... and usually classified by decreasing size (17! Except for the Falconiformes and particularly the Accipitridae family which has no more than three to six microchromosome pairs (24!, the average number ... genetic maps For this purpose, a collection of large insert BAC (bacterial artificial chromosome) and PAC (bacteriophage PI artificial chromosome) clones [80] to be used as microchromosome tags for...
- 11
- 318
- 0
báo cáo khoa học: "Individualized therapies in colorectal cancer: KRAS as a marker for response to EGFR-targeted therapy" docx
... [4,5] KRAS is an important molecule in the EGFR signaling pathway KRAS encodes a membrane-associated GTPase that is an early player in many signal transduction pathways KRAS acts as a molecular on/off ... KRAS MT has worse RR and TTP KRAS MT has worse RR KRAS MT has worse RR, TTP, and OS KRAS MT has worse RR, TTP, and OS KRAS WT has worse OS KRAS WT did not respond KRAS MT has worse RR Escalated ... to panitumumab In each case, KRAS MT was also associated with reduced TTP and OS The data reported by Benvenuti and colleagues [9] showed a two-fold increase in RR associated with KRAS WT status...
- 9
- 311
- 0
Báo cáo y học: "Sensitivity of mice to lipopolysaccharide is increased by a high saturated fat and cholesterol diet" pptx
... HCD increased plasma SAA as seen by others [20], and plasma CD14 was induced (Figure 8A) L-alanine:2-oxoglutarate aminotransferase, ALT Although the consequences of the increases in SAA and CD14 ... Plasma cholesterol was measured with Infinity Cholesterol Reagents (Sigma-Aldrich, Inc., St Louis, MO) Plasma alanine:2-oxoglutarate aminotransferase (ALT), aspartate aminotransferase (AST) were ... mediators Ann N Y Acad Sci 1989, 557:310-5; discussion 315-6 Shimada H, Hasegawa N, Koh H, Tasaka S, Shimizu M, Yamada W, Nishimura T, Amakawa K, Kohno M, Sawafuji M, Nakamura K, Fujishima S, Yamaguchi...
- 11
- 281
- 0
Báo cáo y học: " The utility of the Historical Clinical Risk -20 Scale as a predictor of outcomes in decisions to transfer patients from high to lower levels of security-A UK perspective" pptx
... data Outcome was classed as “success” or “failure” based on the work of Quinn and Ward [27] and Cope and Ward [28] who used similar criteria for outcome measures in their study Success was based ... Historical, clinical and risk subscale as well as total HCR-20 score as a predictor of the outcome “failure” medium secure psychiatric care As far as we know this is the first international study ... adult female or child, robbery and arson, based on the criteria of Bailey and MacCulloch [22] Data analysis Data were analyzed using the Statistical Package for Social Sciences SPSS for Windows...
- 8
- 388
- 0
báo cáo khoa học: " Switching to smokeless tobacco as a smoking cessation method: evidence from the 2000 National Health Interview Survey" pot
... just as likely to cause cancer as smoking cigarettes [20] These findings are in direct contrast to the general agreement among tobacco research and policy experts that ST use is far less hazardous ... ST and pharmaceutical nicotine in a regulatory, legal and social context further suggests that the potential of ST as a cessation aid has been under-realized Nicotine gum and the nicotine patch ... the American Cancer Society Great American Smokeout [25] In 1999 an estimated $200 million was spent on print and broadcast advertising for smoking cessation products [26] In contrast to the heavy...
- 7
- 303
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25