selecting a rectangle causes handles that indicate that it is selected and can be moved to appear
Báo cáo y học: " Caspase-3-mediated cleavage of p65/RelA results in a carboxy-terminal fragment that inhibits IκBα and enhances HIV-1 replication in human T lymphocytes" ppsx
... D94E;D97E-tag and p65 V91L;D94E-tag were resistant to cleavage by both caspase-3 and caspase-6, whereas mutant p65 V91L-tag was resistant to cleavage by caspase-6 and p65 D97E-tag mutant was resistant to ... cleavage by both caspase-3 and caspase-6; single amino acid-substitution mutants p65 D97E-tag (lanes and 6) and p65 V91L-tag (lanes and 8) were resistant to cleavage by caspase-3 and caspase-6, respectively) ... other hand, PMA has been currently described as a potential inhibitor of apoptosis in human T cells [32,33]; PHA is a mitogen usually used to induce HIV-1 replication and significant apoptosis has...
- 20
- 314
- 0
Báo cáo khoa học: " Phylogenetic analysis of three genes of Penguinpox virus corresponding to Vaccinia virus G8R (VLTF-1), A3L (P4b) and H3L reveals that it is most closely related to Turkeypox virus, Ostrichpox virus and Pigeonpox virus" ppt
... studies and drafted the manuscript ND and ALW participated in the design of the study, analyses and interpretation of data and revision of the manuscript All authors read and approved the final manuscript ... identity with both TKPV isolates in subclade A2 , compared to 95% identity with ABPV and FLPV and 94% with PGPVP Taken together these analyses confirm that PEPV belongs to the genus Avipoxvirus, and ... (moulting and/ or nesting) and there are large numbers of mosquitoes present, which act as mechanical vectors to transmit virus (personal communication Dr Nola Parsons, SANCCOB) Further research is underway...
- 5
- 354
- 0
Báo cáo y học: "Combinatorial RNA interference in Caenorhabditis elegans reveals that redundancy between gene duplicates can be maintained for more than 80 million years of evolution" pdf
... [32] - as indicating redundancy Of 143 duplicate gene pairs amenable to analysis by combinatorial RNAi (see Materials and methods, below; Additional data file 2), we found 16 pairs of duplicated ... sma-4 alone) Thus, we can use combinatorial RNAi to recapitulate a previously demonstrated epistatic relationship between SMADs and lon-2 [20] Finally, although we could detect additive RNAi ... collection of mutant strains exists, and even if such strains were all available, large-scale matings are far more laborious in animals than in yeast, and so alternative strategies are needed One...
- 13
- 318
- 0
PEOPLE SAY THAT IT IS SAID THAT
... think that the company is planning a new advertising campaign Journalists report that the President suffered a heart attack We agree that changes to the scheme are necessary I suppose that this ... They believe that the missing boy is wearing a white sweater and blue jeans People say that there is a secret tunnel between those two houses They allege that a stranger has robbed the store ... discover that there is water on Mars They believe that terrorists are operating in Berlin They expect that the space shuttle will return to Earth today People say that the King is making a good recovery...
- 3
- 2,461
- 15
Some people think that it is important to use leisure time for activitiesthat improve the mind
... watching TV induces mood and brain states akin to mild depression and anxiety, although watchers themselves may be unaware of it The popular genre of forensic crime shows appears to have a particularly ... a markedly improved mood during and after the dinner party, despite their grumbling Our beliefs about what we enjoy can be inaccurate, and this is one reason why in leisure, as in life, we can ... unwittingly doing things that bring us less overall joy and satisfaction Another reason is that getting the most out of our leisure can initially feel like hard work Finding deep and lasting gratification...
- 4
- 602
- 0
báo cáo khoa học: " A review of health system infection control measures in developing countries: what can be learned to reduce maternal mortality" pps
... Maternal, Newborn and Child Health); and quality, patient safety and surveillance organisations (Agency for Healthcare Research and Quality, Centres for Communicable Diseases, National Institute ... studies were in Asia (Nepal, India, Pakistan, Thailand), Africa (Egypt, Malawi, Mozambique, South Africa) and South America (Argentina and Columbia) Characteristic problems related to infection ... deaths In Latin America and the Caribbean, its contribution to maternal mortality is 7.7%, ranking lower than hypertensive disorders, haemorrhage, obstructed labour and abortion In Africa and Asia,...
- 9
- 551
- 0
A blended future the changing mix of IT service delivery and consumption
... business unit’s purchasing and consumption of IT services? Austria, Bahamas, Barbados, Belgium, Brazil, Canada, Malaysia, New Zealand, Nigeria, Norway, Oman, Pakistan, Sweden, Switzerland, Thailand, ... CIOs regard shadow IT as counterproductive and actively discourage it, 78% are mitigating risks by taking a more proactive approach to information and security across their organisations Equally ... data suggest that CIOs are expanding their role to manage a portfolio of IT capabilities that include internal infrastructure assets, local and externally developed applications, and third-party...
- 29
- 214
- 0
Requiem for a love that it had to die...
... will advances and the reserve of the past calms her down Then they go, or at least they think so They head to the ocean and they leave The love agony was never a bearable landscape Never It hurts ... waves for not having those lips being attentive And wise are the winds which in that dark night dress like hurricanes and strike the ship with knavish hatreds, with blows of break Without any ... sense of tomorrow inert And leaving is healthy, even with the rancor of dizziness In search of a nice awakening, painting that hair with silver color, still perfumed, dyeing that face with shadows,...
- 18
- 360
- 0
How This Book Can Help You Develop a Powerful Business Plan That Works
... plan into five pages HOW TO CONVERT YOUR GOALS INTO PRACTICAL BUSINESS BEHAVIOR Over the years I have met and worked with thousands of managers as a consultant and trainer So many of you have told ... some way to your strategic goals The reverse is also true Your goals must be converted to practical, daily behavior A critical point raised in my many discussions with managers is the failure ... type of management behavior is unacceptable To change it requires a change in the planning framework Built into the backPlanning model is a mechanism requiring the plan to be communicated to every...
- 10
- 520
- 0
How to Create a Compelling Company Story That Inspires Employees to Excel
... them to live up to their word and match word and deed Reaching a state where you and your management team are believed is a journey with history working against you A mismanagement example made ... company in assorted media events Their product is usually an ad campaign or program to catch public attention There is nothing wrong with that approach except that it is usually just that an annual ... your story Not all is lost if your story is less than desirable You can shape it into anything you wish You may decide to be creative or allow it to be dull and boring It may be developed around...
- 24
- 627
- 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... by plant-associated bacteria such as Xanthomonas campestris, Pseudomonas syringae and Erwinia carotovora Despite some sequence similarity, this group is distinct from that of the AppA-related ... substrate-free PhyK with substrate-free ˚ AppA the Ca atoms are 2.41 A apart, whereas for the substrate-free PhyK and the substrate-loaded AppA ˚ the averaged distance is only 1.87 A Distinct ... only in an orientation with the 3-phosphate as a scissile group Leu24 and Glu196 in G1P are proposed to act as ‘gating residues’ that narrow access to the comparatively stiff and small substratebinding...
- 13
- 766
- 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs ... dedicated to cellulose degradation [43,44] or that can be exploited for this purpose (expansins [45]; see also [46]) exist Materials and methods Bacterial strains and plasmids and cultivation Lactococcus ... optima for activity, whereas enzymes with more neutral pH optima have an aspartic acid at this position For the latter type of enzyme, it has been shown that mutation of aspartic acid to asparagine...
- 14
- 683
- 0
Tài liệu Managed Investment Funds Product Disclosure Statement - A range of funds that allows you to create an investment portfolio that suits your individual needs ppt
... over the page… Documents that are written in a language that is not English must be accompanied by an English translation prepared by an accredited translator An accredited translator is any person ... paragraphs (a) to (f) is a separate right, and this clause A is to be read as if such change was a separately expressed right B Changes to terms and conditions may from time to time change any ... personal information may also be used by us to administer, monitor and evaluate products and services, gather, aggregate and report statistical information, assist you with any queries and take measures...
- 52
- 577
- 0
Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx
... PGDH appears to be absent in other parasitic and nonparasitic protists, including Plasmodium, Giardia, Trypanosoma, Trichomonas, Toxoplasma, Schistosoma, Cryptosporidium and D discoideum, although ... corresponding to an open reading frame (ORF) of EhPGDH was amplified by PCR using a cDNA library [26] as a template, and oligonucleotide primers (5¢-caGGATCCaagatagttgtgataac cga-3¢ and 5¢-caCTCGAGttagaacttattgacttggaa-3¢), ... neurological disorders, i.e congenital microcephaly, dysmyelination, intractable seizures, and psychomotor retardation Entamoeba histolytica is the enteric protozoan parasite that causes amoebic colitis...
- 12
- 464
- 0
Báo cáo khoa học: Plant DNA polymerase k, a DNA repair enzyme that functions in plant meristematic and meiotic tissues docx
... dNTP was analyzed by M urea and 10% PAGE and autoradiography (B) TdT activity was measured under the conditions described in Materials and methods Commercial TdT (Takara) was assayed as a positive ... the AP site-containing strand was 3¢-end-labeled with [a- 32P]ddATP, annealed to its complementary strand and treated with human AP endonuclease to release a dRP-containing substrate (Fig 4A) This ... S., Kasai, N., Shimazaki, N., Takemura, M., Asahara, H., Linn, S., Yshida, S., Matsukage, A. , Koiwai, O., Sugawara, F., Yoshida, H & Sakaguchi, K (2002) A plant phytotoxin, solanapyrone A, is an...
- 9
- 492
- 0
Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt
... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG ... A H V T L N V K S A * ATGCGAGGTCAGCATTTATCCAACCAGAAGCTTCACGGAGCTAGCTGGGCAAGGAAATTT GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC AACGCCACCTTTTTATTTTTAATCATATATCATCTCAGTGAAGGTCAGTCCTTG...
- 11
- 501
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... fact that Esc(1–18) possesses a wide spectrum of antimicrobial activity against several species of Grampositive bacteria, Gram-negative bacteria, Candida and multidrug-resistant nosocomial pathogens, ... Mangoni ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues ... We thank M Simmaco for use of the facilities and platforms available in the DiMA Unit of the Sant’Andrea Hospital This work was funded in part by Italian ` Ministero dell’Universita e Ricerca (PRIN...
- 18
- 494
- 0
Báo cáo khoa học: Cytosolic phospholipase A2-a and cyclooxygenase-2 localize to intracellular membranes of EA.hy.926 endothelial cells that are distinct from the endoplasmic reticulum and the Golgi apparatus pdf
... cPLA2 -a and convert arachidonic acid into prostaglandin H2 [8,9] To date, two distinct COX isoforms, COX-1 and COX-2, have been identified and characterized, and an alternative splice variant ... cPLA2 -a at its site of localization Several studies have also implied that cPLA2 -a may be regulated by cytoskeletal interactions Cytochalasin B, an inhibitor of actin polymerization, was shown to ... types, antibodies and methods have been used, the exact site of cPLA2 -a relocation remains unknown, and appears to be cell specific In the majority of studies, cPLA2 -a has been reported to translocate...
- 13
- 387
- 0
Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversification of b-toxins ppt
... a characteristic paralysis (transient immobilization and contraction replaced by gradually increasing flaccidity) was obtained and lasted at least 15 ED50 values were calculated as was described ... [40] and Buthus martensii Karsch [25] Another peculiar toxin that competes for both a and b-toxin receptor sites in rat brain synaptosomes, AahIT4, seems to be related to b-toxins because it was ... compete with a- (Aah2) and b- (Css2) anti-mammalian toxins for binding to rat brain synaptosomes [23] As AahIT4 shares little sequence similarity with any of the known anti-mammalian scorpion toxins...
- 8
- 391
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose