... personalit y Have fun on Twitter During Clint Eastwood's "Invisible Obama" speech next to an empty chair at the Republican National Convention, the Obama digital media team tweeted a photo captioned: ... clicked on "Big Bird." Build and engage your communit y Find out what people expect and want from your brand As an example, Steele said the Romney campaign posts behind -the- scenes campaign trail ... common interests For example, Steele said a third-party conservative group tweeted about ABC's Dancing With the Stars during the show Move people t o act ion Steele says, like the political campaigns,...
... operations are included in Table above, along with emissions from primary manufacturing operations Table lists the stationary direct GHG emission sources found inthe pulp and paper manufacturing ... chemicals The addition of sodium and calcium in forms that not contain carbon, such as Na2SO4, NaOH, and CaO, would further minimize the need for carbonate makeup chemicals and is a practice ... for anaerobic decomposition of organic matter There are, however, operations that can contain zones that become anaerobic, including aerated stabilization basins (ASBs), primary settling basins,...
... Summary The National Aeronautics and Space Administration (NASA), in cooperation with the Japan Aerospace Exploration Agency (JAXA), launched the Tropical Rainfall Measuring Mission (TRMM) in ... for sampling of the diurnal variation of precipitation The ability to map and monitor rain at nonstandard viewing times (relative to the polar-orbiting satellites) permits a better understanding ... National Aeronatuics and Space Administration (NASA) will weigh the research and operational benefits against the cost of extending the mission for approximately one year If NASA decides to continue...
... cracking is arbitrary and depends onthe situation being considered The mechanisms by which materials fail depend, among other things, on temperature, the loading conditions andthe loading rate ... exhibit plastic flow and strain hardening, which is associated with increase inthe number of defects caused by plastic deformation In strain hardening the strength of the material gradually increases ... Semiconductor devices are based ona vast variety of thin conducting and insulating layers in contact with each other as well as to semiconducting materials [3] Therefore, the interfacial compatibility...
... Dioxin from Pulp and Paper and Lead in Soil at Mining Sites i Abstract This paper discusses EPA’s acquisition and use of science in addressing dioxins (and other organochlorines) fromthe pulp and ... state environmental agencies, the analytically and politically daunting task of setting and allocating innumerable TMDLs makes it all the more appealing to formulate national, technology-based ... seen, and even once activity begins, the cell’s internal regulation system has some capacity to adapt to changing hormonal levels and maintain the mix within the range of tolerance Inthe view...
... a COX IV NRF-1 b-actin a Antisense primer (5¢)3¢) GenBank acc no AGAAGGCGCTGAAGGAGAAGGA ATGGGCCAATGTCCGCAGTGATGTC GAACCCTAAGGCCAACCGTGAAAAGAT CCAGCATGCCGAGGGAGTGA GGTGGCCTCTGATGCTTGCGTCGTCT ACCGCTCGTTGCCAATAGTGATG ... white fat of the adult transgenic animals demonstrated that the unilocular cells had a larger cytoplasmic area and contained more numerous and larger mitochondria with a relatively high cristae ... [43], the metabolic rate was relatively high andthe treatment induced formation of mitochondria inthe multilocular cells in white fat depots [10] Also cold acclimatization induces mitochondrial...
... cycles, averaged 6.3% with 1.4 standard deviations, and real environmental expenditures averaged $624.2 million per year 14 An analysis of the correlation matrix among these variables indicated a relatively ... Based onthe above results, we find that market concentration has a positive and significant effect on price-cost margins inthe pulp and paper industry It appears that if the market concentration ... profitability As a result of accelerated consolidation activities, the market concentration in pulp, paper and paperboard sector has been rising steadily Therefore, the impact of consolidation on...
... Page of unchanged cardiovascular, pulmonary, and gastrointestinal examination However, on neurological examination, he was lethargic, and found to have dysarthria and ataxia A computed tomography ... Helminths and protozoa can cause parasitic brain abscesses, but these are rare Clinical presentation Patients with brain abscess may present a myriad of complaints including headache, mental status ... visit and requested admission for observation The ED physician agreed and consulted the pediatric admission team to evaluate the patient After admission was arranged there was a delay in transporting...
... labour and capital, of the extraordinary development of industrial machinery, of the new and intricate organisation of corporation finance, andin particular I want to try to analyse—no one has ... husbandman, after having taken from his field all the straw that is there, rakes it over with a wooden rake and gets as much again The wise child, after the lemonade jug is empty, takes the lemons ... guineas This alone guarantees for all intelligent readers a palpitating interest in every line of it Among the thousands of MSS which reached us—many of them coming in carts early inthe morning,...
... (highest point onthe head when the head is held inthe Frankfurt Horizontal plane) andthe floor Each participant was asked to stand up against the wall with hands hanging down, feet axes parallel ... strictly marrying within their own caste The majority of the individuals from these caste groups are engaged in agriculture, and animal husbandry Data collection and anthropometry The data for the present ... taking informed consent The data were collected inthe month of October-November 2006 fromthe educational institutions located inthe villages of Nanakpur, Marranwala and Bassolan The participants...
... regarding quality and litigation, the main advantages being saving time and money fromthe UK side, and generating revenues fromthe Indian side, and protectionism and lack of recognition being ... drawn out between the two countries, where conditions can be agreed upon, such as outlining data regulations and security, litigation procedures and liability, and regulation and recognition ... concerns regarding data security, recognition of qualifications and legal liability [12] The literature review had two main conclusions First, very little data was found onthe amount of trade...
... ground barley with a supplement of proteins, minerals and vitamins throughout the experiments Parasite The CEP-strain of Ascaris suum was isolated in 1993 and since then maintained by passage in helminth ... suggested that an easily available energy source, like 1% glucose, inthe incubation saline andinthe agar may increase the motility of the larvae and thereby increase the recovery The results ... tested to prevent larvae from "swimming" inthe jars Glucose was added to the saline of some of the samples to a final concentration of 1% inthe agar-gels andthe incubation saline About 500 ml of...
... research will involve the development of an instrument, evaluation of content validity and clarity through cognitive debriefing interviews, and quantitative evaluation of reliability, validity, and ... situations and having concerns that their coughing disturbs others around them In addition, participants discussed the impact of cough on their emotional state, including feelings of annoyance, irritation, ... gonna break a rib or anything It' s-but it' s hacking And when I have a cough on those occasions, it' s probably close to a ten I mean, it will just – I mean, it will just continue andit' s painful,...
... study analysis and summary GMX and WMW obtained the data GMX, JW, ZHL and WMW participated inthe data analysis and interpretation of the results All authors reviewed the final version Acknowledgements ... progesterone The appearance, packaging and administration of placebo and progesterone injections were the same for the two groups All patients, treating physicians, nursing staff, and pharmacists ... ventilation to maintain the oxygen pressure at a minimum of 100 mmHg andthe carbon dioxide pressure at approximately 35 mmHg Randomization and medication administration The prospective, randomized,...
... February 2011 began growing in 2005 For this reason and also to investigate the accuracy of the initial determinations we obtained a second sample of hair about months after the initial sample from ... congenital anomaly In two cases, hair fromthe child was also obtained We obtained the clinical details of the congenital anomaly, the age of the parents, their smoking history and alcohol drinking ... we have ourselves made a study [Alaani S.; Busby C; Hamdan M; Al-Fallouji M: Infant mortality, sex ratio, congenital anomaly and environmental contamination in Fallujah, Iraq, submitted] of the...
... America: Canada, andthe United States; South America: Brazil, and Uruguay; Asia: China, Indonesia, Japan, and Singapore; and Australia Cost analysis All costs were converted to US dollars based on ... published exchange rates as of June 1, 2009 Information on nursing assignments was available from all sites Nursing time was determined by calculating the cost of additional nursing staff assigned ... CRRT were calculated from each commercial supplier used by each institution Data on fluid use was available from all sites, however the actual costs of each fluid was available from 50 sites We...
... selection and model validation means investigating whether the dynamics of the calibrated state variables correspond to the dynamics implied by the equations and model parameters Scenario analyses ... discounting framework are consistently lower than inthe Libor framework This arises fromthe fact that inthe OIS framework the swap annuity increases, causing an increase inthe IR vanilla swap ... derivatives prices, the combination of equations and model parameters denes the dynamics of the state variables inthe risk-neutral measure Onthe other hand, the calibrated daily evolution of the...
... Political Science international corporate law and financial market regulation Recent years have seen an upsurge of change and reform in corporate law and financial market regulation internationally as ... organized in such a way as to facilitate contacts with the public at large As for investment consultants, they are still far removed fromthe developed stage they have attained onthe capital markets ... had a far-reaching in uence onthe EC retail market agenda.45 The explosive combination of the Lamfalussy law-making reforms andthe FSAP regulatory reform agenda led to an exponential increase...
... to put some money in, or you can put some in - yourself, this will make the bank more likely to lend to you Go to lots of banks, not just the one you have your current account with Mọi người ... cần tự tin (vì bạn khách hàng họ, bạn thượng đế) Vào ngân hàng, văn phòng làm việc, quán karaoke hay công viên, bạn - phải ăn mặc, nói lịch họ thấy nghiêm túc bạn If you can get someone else ... Một điều quan trọng n a, gặp ngân hàng, bạn cần cho họ thấy khả nhà lãnh đạo Bởi thể phần tính khả thi dự án Nếu bạn nhà lãnh đạo luộm thuộm, léo & thông minh Chắc chắn họ không giao tiền cho...