0

secure socket layer ssl is a protocol that is restricted to asymmetric encryption

Secure Socket Layer (SSL) là gì?

Secure Socket Layer (SSL) là gì?

Thương mại điện tử

... khai, cho mã hoá va xác thực, phát triển bởi Rivest, Shamir và Adleman; 7. RSA key exchange - thuật to n trao đổi khoá cho SSL d a trên thuật to n RSA; 8. SHA-1 - thuật to n hàm băm an to n, ... mềm). Secure Socket Layer (SSL) là gì? Nguồn: Chungta.com SSL là giao thức a mục đích được thiết kế để tạo ra các giao tiếp gi a hai chương trình ứng dụng trên một cổng định trước (socket ... Internet Draft được tích hợp và hỗ trợ trong sản phẩm c a Netscape. Giao thức SSL làm việc như thế nào?Điểm cơ bản c a SSL được thiết kế độc lập với tầng ứng dụng để đảm bảo tính bí mật, an to n...
  • 4
  • 769
  • 4
Tài liệu Giới thiệu về giao thức bảo mật phổ biến cho TMĐT:Secure Socket Layer (SSL) doc

Tài liệu Giới thiệu về giao thức bảo mật phổ biến cho TMĐT:Secure Socket Layer (SSL) doc

Thương mại điện tử

... thiệu về giao thức bảo mật phổ biến cho TMĐT :Secure Socket Layer (SSL) Secure Socket Layer (SSL) là gì? SSL là giao thức a mục đích được thiết kế để tạo ra các giao tiếp gi a hai chương ... tay” (handshake protocol) và giao thức “bản ghi” (record protocol) . Giao thức bắt tay xác định các tham số giao dịch gi a hai đối tượng có nhu cầu trao đổi thông tin hoặc dữ liệu, còn giao ... Shamir và Adleman; 7. RSA key exchange - thuật to n trao đổi khoá cho SSL d a trên thuật to n RSA; 8. SHA-1 - thuật to n hàm băm an to n, phát triển và sử dụng bởi chính phủ Mỹ 9. SKIPJACK...
  • 5
  • 632
  • 1
Tài liệu Secure Socket Layer (SSL) là gì? pdf

Tài liệu Secure Socket Layer (SSL) là gì? pdf

Internet Marketing

... và thanh to n điện tử Giao thức SSL d a trên hai nhóm con giao thức là giao thức “bắt tay” (handshake protocol) và giao thức “bản ghi” (record protocol) . Giao thức bắt tay xác định các tham số ... Secure Socket Layer (SSL) là gì? SSL là giao thức a mục đích được thiết kế để tạo ra các giao tiếp gi a hai chương trình ứng dụng trên một cổng định trước (socket 443) nhằm mã hoá to n ... điện tử (digital certificate) d a trên mật mã công khai (thí dụ RSA). Sau đây ta xem xét một cách khái quát cơ chế hoạt động c a SSL để phân tích cấp độ an to n c a nó và các khả năng áp dụng...
  • 2
  • 636
  • 1
SSL (Secure Socket Layer) pptx

SSL (Secure Socket Layer) pptx

An ninh - Bảo mật

... & receives an authorization from issuer8. sends authorization response back to merchant SSL Handshake Protocol ãallows server & client to: ãauthenticate each otherã to negotiate ... encryption & MAC algorithmsã to negotiate cryptographic keys to be usedãcomprises a series of messages in phasesãEstablish Security CapabilitiesãServer Authentication and Key ExchangeãClient ... Internet standard known as TLS (Transport Layer Security)ãuses TCP to provide a reliable end -to- end serviceã SSL has two layers of protocols SSL Record Protocol ãconfidentialityãusing...
  • 23
  • 581
  • 2
Báo cáo khoa học: A designed curved DNA segment that is a remarkable activator of eukaryotic transcription potx

Báo cáo khoa học: A designed curved DNA segment that is a remarkable activator of eukaryotic transcription potx

Báo cáo khoa học

... 5Â-GTTTTTCATGTTTTTCATGTTTTTCATGTTTTTCAC-3Â and 5Â-GTGAAAAACATGAAAAACATGAAAAACATGAAAAAC-3Â,was inserted into the PmaCI site of pLHC4 ⁄ TLN [12] byblunt-end ligation. After a conventional cloning and screen-ing ... andpLHC40 TLN-6, respectively.Group IISynthetic oligonucleotides 5Â-TCAGTTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAC-3Â and5Â-GTGAAAAACTGACTGAAAAACTGACTGAAAAACTGACTGAAAAACTGA-3Â were annealed ... Health Science, Odawara,Japan, and Y. Kadokawa). The plasmid was digested withSalI, blunted with S1 nuclease, and digested with XhoI. A resulting fragment containing a loxP site was isolated...
  • 12
  • 399
  • 0
the nothing that is, a natural history of zero - robert kaplan

the nothing that is, a natural history of zero - robert kaplan

Vật lý

... wasn't all that bad.This is a spectacular application of the Greek insight that theworld afar can be grasped by analogy to the world at hand.But it is made much more spectacular ... individuals and instances, lungingalways toward generalities and abbreviating the singularity ofthings to an Escher array, an orchard seen from the air ratherthan this gnarled ... it to the West. In this book youwill see it appear in Sumerian days almost as an afterthought,then in the coming centuries casually alter and almost as casuallydisappear, to ...
  • 238
  • 5,165
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Báo cáo khoa học

... in a mutant that lacks NirF; this too is not trivial as the DnirF straindoes not accumulate readily detectable amounts of anintermediate of d1synthesis.Experimental proceduresDNA manipulationsDNA ... 252.221.81.41.21.610.80.60.40.20 A 600 A 600 A 600Time (h)Fig. 5. His41 is essential for Paracoc-cus pantotrophus NirF, but Asp129 is dis-pensable. Growth plots and time courses ofnitrite appearance and disappearance ... pH 7.5 and stored at)80 °C. The supernatant from the 150 000 g step was keptas cytoplasm and stored at )20 °C.Paracoccus pantotrophus strains were grown anaerobicallyin 50 mL minimal salt medium...
  • 12
  • 613
  • 0
Tài liệu Báo cáo Y học: Ornithine decarboxylase-antizyme is rapidly degraded through a mechanism that requires functional ubiquitin-dependent proteolytic activity pot

Tài liệu Báo cáo Y học: Ornithine decarboxylase-antizyme is rapidly degraded through a mechanism that requires functional ubiquitin-dependent proteolytic activity pot

Báo cáo khoa học

... Murakami, Y., Matsufuji, S., Kameji, T., Hayashi, S., Igarashi,K., Tamura, T., Tanaka, K. & Ichihara, A. (1992) Ornithinedecarboxylase is degraded by the 26S proteasome withoutubiquitination. ... 647–651.29. Kahana, C. & Nathans, D. (1984) Isolation of cloned cDNAencoding mammalian ornithine decarboxylase. Proc. Natl Acad.Sci. USA 81, 3645–3649.30. Graham, F.L. & van der Eb, A. J. (1973) ... degradation.DISCUSSIONAntizyme is a unique cellular regulatory protein that is bothregulated by polyamines and regulates polyamine metabo-lism in a feedback loop. Antizyme expression is regulatedtranslationally...
  • 7
  • 382
  • 0
Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx

Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx

Sức khỏe phụ nữ

... USAEmail: Min Liu - corticalgranules@hotmail.com; Andrea Oh - andrea.oh@email.ucr.edu; Patricia Calarco - calarco@itsa.ucsf.edu; Michiyuki Yamada - myamada@yokohama-cu.ac.jp; Scott A Coonrod - scc2003@med.cornell.edu; ... p75 obtained from MS/MS analy-sis was searched against listed PADs and residues that were matched to it are marked (*). The signal peptide cleavage site is marked with an arrow. The monopartite ... PAD is released from the cortical granules at fertilization, andafter its release, it remains associated with the zygote's andblastomeres' plasma membranes where it appears to playa...
  • 22
  • 519
  • 0
Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt

Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt

Báo cáo khoa học

... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG 2459 AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC 2519 TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG 2639 TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT 2699 TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC ... CCGCAGCTCAGTGGTGTCAAGGCCCATGTCACACTCAATGTCAAGAGTGCTTAATTTGCT 2279 P Q L S G V K A H V T L N V K S A * ATGCGAGGTCAGCATTTATCCAACCAGAAGCTTCACGGAGCTAGCTGGGCAAGGAAATTT 2339 GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT 2399 ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG...
  • 11
  • 501
  • 0
Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx

Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx

Báo cáo khoa học

... used for generating the ve mutants were:C126S, 5Â-TAATTTAAAAGCCGTTGTATCCTTTGGTGAATCTT-3Â; C12 6A, 5Â-TAATTTAAAAGCCGTTGTAGCTTTTGGTGAATCTT-3Â; C126V, 5Â-TAATTTAAAAGCCGTTGTAGTTTTTGGTGAATCTT-3Â; C126M, ... 5Â-TAATTTAAAAGCCGTTGTAATGTTTGGTGAATCTT-5Â;and C126T, 5Â-TAATTTAAAAGCCGTTGTAACTTTTGG TGAATCTT-3Â.Protein expression and purificationThe TIM gene carrying the mutation was expressed inE. coli AA200 ... site-specificmutagenesis – distal effects on dimer stabilityMoumita Samanta1, Mousumi Banerjee1, Mathur R. N. Murthy1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian...
  • 12
  • 393
  • 0

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25