schematic of the dna hybridization process the quot matched quot side shows how a dna strand correctly binds to its complement and the quot mismatched quot side shows how errors can prevent binding
Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt
... cleavage The panel on the left shows cleavage in a 5¢-labeled, symmetric, 70 nucleotides single-stranded DNA substrate, whereas the panel on the right shows cleavage in a 5¢-labeled top -strand, ... control in the assays Schematic diagrams of the mobility assays are shown at the top (not drawn to scale) The SalI restriction sites (S) in the plasmids as well as the orientation of the target with ... include random nonspecific opposite -strand nicks, a nascent leading strand or de novo initiation of cDNA synthesis Because most of these mutants were able to cleave single- and double-stranded DNA substrates...
- 11
- 398
- 0
The research is a sure-fire solution to apply on realistic condition due to its feasibility and low cost for a development of sustainable agriculture in Vietnam as the top aims of Sony Green competition
... float: Table: Some of aquatic plants popular Type Aquatic plant live sink Scientific name Hydrilla verticillata Myriophyllum spicatum Blyxa aubertii Eichhornia crassipes Aquatic plant Wolfia arrhiga ... Since then we can compare with different concentration, analyse data of study and conclude about the waste treatment of Ludwigia - Experiment is disposed such as: Each brass basin has 10l (waste ... of leafs on each of plant + Observe figure of plant (colour of leafs and body) Water experiment: + Mark water-level in each of brass basin + Collect specimen and analyse some chemical-physical...
- 16
- 518
- 0
Báo cáo khoa học: Assembly of nuclear DNA-encoded subunits into mitochondrial complex IV, and their preferential integration into supercomplex forms in patient mitochondria doc
... possibly after addition of the late-assembling subunits Cox 6a and Cox 7a Based on the results presented here, it appears that subunits that are incorporated late in the assembly pathway have a greater ... integration of the subunits into the final complex Alternatively, Cox 6a and Cox 7a may integrate into the LSI complex and then be transferred into the maturing complex IV Integration of nDNA-encoded ... that involve formation of the catalytic core The remaining nDNA-encoded subunits are thought to be added during the last steps of assembly; however, this part of the assembly pathway is the least...
- 13
- 314
- 0
PROSPECTS FOR THE EU PRINTING SECTOR TO RESPOND TO ITS STRUCTURAL AND TECHNOLOGICA, CHALLENGES pptx
... years ago, to a location further away from their homes, and with public transport always either on strike or running late Marc had warned them that they would have to travel by car anyway due to ... to evolve and improve its competitiveness Phase Phase Assessment Assessment of impacts of impacts • Measure and evaluate threats and opportunities • Measure and evaluate the foreign structural ... the manufacturers to take advantage of economy of scale, then distributing the printing to a panel of capacity printers •This could moderate the concentration of the industry as it prevents the...
- 148
- 296
- 0
Tài liệu Báo cáo khoa học: Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation doc
... QLD, Australia) Plasmids and cDNAs The mammalian expression plasmid, pcDNA3 (Invitrogen, Melbourne, VIC, Australia), containing N-terminally flagtagged human Salvador (hSav) cDNA was a kind gift ... phosphorylation played in the ability of Mst to increase the abundance of Sav To this we coexpressed both WT and kinase-dead mutants of Mst1 and Mst2 with flag-Sav, and determined the effect of these ... Clearly the regulation of the Mst1 and Mst2 in mammals is more complex especially as orthologues of Nore1 and Rassf1 not appear to exist in flies How the Sav ⁄ Mst pathway contributes to apoptosis and...
- 13
- 321
- 0
Báo cáo hóa học: " Research Article A Novel Signal Processing Measure to Identify Exact and Inexact Tandem Repeat Patterns in DNA Sequences" potx
... base repeat pattern, for instance, repeat like AAAAA in DNA sequence ACGACAAAAACAACG because the repeat pattern of period is of no interest In step (4), the energy of the input signal is decomposed ... Signal Processing Magazine, vol 18, no 4, pp 8–20, 2001 [16] S Tiwari, S Ramachandran, A Bhattacharya, S Bhattacharya, and R Ramaswamy, “Prediction of probable genes by Fourier analysis of genomic ... EXPERIMENTAL RESULTS To demonstrate the capabilities of the repeat pattern identification algorithm, experiments were performed on datasets of some actual DNA sequences available at GenBank database The...
- 7
- 206
- 0
Báo cáo hóa học: " Research Article A Novel Signal Processing Measure to Identify Exact and Inexact Tandem Repeat Patterns in DNA Sequences" pdf
... base repeat pattern, for instance, repeat like AAAAA in DNA sequence ACGACAAAAACAACG because the repeat pattern of period is of no interest In step (4), the energy of the input signal is decomposed ... Signal Processing Magazine, vol 18, no 4, pp 8–20, 2001 [16] S Tiwari, S Ramachandran, A Bhattacharya, S Bhattacharya, and R Ramaswamy, “Prediction of probable genes by Fourier analysis of genomic ... EXPERIMENTAL RESULTS To demonstrate the capabilities of the repeat pattern identification algorithm, experiments were performed on datasets of some actual DNA sequences available at GenBank database The...
- 7
- 391
- 0
Báo cáo khoa học: "Optimization of in situ hybridization assay using nonradioactive DNA probes for the detection of canine erpesvirus (CHV) in paraffin-embedded sections" pdf
... Kim Table Comparison of different protocols for the detection of canine herpesvirus DNAs in paraffin sections by in situ hybridization Labelsb Protease Kc Hybridizationd 100 Titer of inoculated ... detection of intracellular viral DNAs in paraffin sections J Vet Med Sci 2003, 64, 231-235 73 Kim O, Chae C In situ hybridization for the detection and localization of porcine epidemic diarrhea virus ... fixed and paraffin embedded CHV-infected cells The optimum result was obtained using digoxigenin-labeled probe, 100 µg/ml proteinase K pre-treatment, and overnight hybridization The practicality of...
- 3
- 301
- 0
Báo cáo y học: "Expression of hMSH2 protein of the human DNA mismatch repair system in oral lichen planus"
... epithelial basement membrane, degeneration of basal keratinocytes, hyperkeratinization and acanthosis [24] Basal cells are the prime target of destruction in OLP The mechanism of basal cell damage ... forms are usually painless and appear clinically as white keratotic lesions The erosive, atrophic and bullous forms are often associated with a burning sensation and in many cases can cause severe ... inflammation and cancer risk include, inflammatory bowel diseases and colorectal cancer, atrophic gastritis and gastric cancer, gall bladder Int J Med Sci 2004 1(3): 146-151 149 cancer related to...
- 6
- 461
- 0
USING THE ANALYTIC HIERARCHY PROCESS APPROACH FOR ASSESSMENT OF THE STRENGTH OF UNIVERSITY-INDUSTRY-GRI COOPERATION IN VIETNAM
... authority and loyalty A similar analogy can be drawn for the differences that exist at large between the scientific or academic world and the world of organizations and management as shown in Table ... importance of these criteria apart from any alternatives they may be considering Related to this are situations where they have ranked their alternatives by assuming that the ones they are aware of ... example: • To maintain a balance between attention to research and development and to build the capable human resources • To bridge communication gap and assist the growth and development of...
- 73
- 495
- 2
Characterization of the microbial community in the anaerobic/oxic/anoxic process combine
... percent of the mixture of effluent and backwash water from the column was circulated back to the anaerobic tank, and the residue was circulated back to the oxic tank The solid residuals after ozonation ... 305-313 Standard Methods for the Examination of Water and Wastewater (1995) 19th edn, American Public Health Association/American Water Works Association/Water Environment Federation, Washington DC, ... in relation to members of the Bacteroidetes (A) , Betaproteobacteria (B), and Alphaproteobacteria (C) The root of the tree was determined by using the 16S rRNA gene of Methanosarcina mazei (AB065295)...
- 8
- 573
- 4
Evaluation of the Innovated Disinfection Process with High Dissolved CO2
... (Japan Sewage Works Association) (1997) Standard methods for the examination of sewage wastewater (Japanese), Tokyo, Japan, 698-718 Jyoti K K and Pandit A B (2004) Ozone and cavitation for water ... leading to the slower FC inactivation The results also revealed that it was possible to reach a high FC log-inactivation of 2.8 for the canal and river waters in 20 Canal water contained a very high ... Standard methods for the Examination of Water and Wastewater, AWWA and WCPC, Washington D.C Dixon N M and Kell D B (1989) The inhibition by CO2 of the growth and metabolism of micro-organisms, J Appl...
- 8
- 421
- 0
Module 4: Overview of the Windows CE .NET Debugging Process
... can expand the variable to see all of its members Automatic Downcasting The Watch window also performs automatic downcasting For example, if a variable that is declared as a pointer to a C++ CObject ... you want to watch together onto the same tab Example You could put variables related to a specific window on one tab and variables related to a dialog box on another tab You could watch the first ... that matches the search The Advanced Memory dialog box allows you to search for data inside the system memory It can search for several types of data and then list the memory location that matches...
- 34
- 394
- 0
DNA by Design. Stephen Meyer and the Return of the God Hypothesis
... manifesto, which pledges “nothing less than the overthrow of materialism and its cultural legacies” and the renewal of a broadly theistic understanding of nature.”10 Thaxton and Meyer say that ... necessity of the God hypothesis.12 Meyer argues that it was a mistake for natural theologians to retreat in the face of science to the idea that design was located in the laws of nature, rather than ... separateness) were separately created at that time? What about those phyla that arose before or afterward? And why the invariable focus at the arbitrary level of the phylum; isn’t it rather the...
- 19
- 457
- 0
Tài liệu Implementation of the Asthma Practice Guideline in the Army Medical Department - Evaluation of Process and Effects pdf
... Administration Systems and Biostatistical Activity Primary care manager Pharmacoeconomic Center Patient-Level Cost Allocation Quality management Standard Ambulatory Data Record Standard Inpatient Data ... Unavailable data At the system level, the data needed to calculate many indicators (e.g., laboratory or radiology data) were incomplete, were obtained from separate data-extraction processes of ... from a low of 0.98 at Blanchfield ACH to a high of 3.11 at Moncrief ACH The four MTFs also vary in other clinical and educational activities, as shown in Table 1.3 Martin ACH and Eisenhower AMC...
- 212
- 442
- 0
Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc
... glycerol, and the flow rate was 0.5 mLÆmin)1 CD measurements DNAs The /X174 phage ssDNA and dsDNA used in the DNA binding and ATPase assays were purchased from New England Biolabs (Ipswich, MA, USA) ... should affect the DNA binding of the protein The DNA- binding ability of these alanine-substituted Rad51 mutants was evaluated by a gel retardation technique and by measurements of the DNA- dependent ... excitation of the tryptophan residue The spectra were measured at least twice to verify the absence of significant photobleaching, and were averaged to increase the signal to noise ratio All of the...
- 12
- 662
- 0
Tài liệu Báo cáo khoa học: DNA strand exchange activity of rice recombinase OsDmc1 monitored by fluorescence resonance energy transfer and the role of ATP hydrolysis pptx
... 5¢-CGTTCTTATTACCCTTCTGAA TGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢ and M13C: 5¢-CTACAACGCCTGTAGCATTCCACAGA CAGCCCTCATAGTTAGCGTAACGAGATCG-3¢ Phi-C and Phi-W were complementary to each other Phi-C was labeled ... (55-mers) for strand exchange assay were synthesized by Metabion (Martinsreid, Germany) with the following sequences: PhiC: 5¢-CGATACGCTCAAAGTCA AAATAATCAGCGTGACATTCAGAAGGGTAATAAG AACG-3¢;, PhiW: ... will therefore unveil the status of physical union and separation of complementary strands during renaturation and strand exchange, respectively, and thereby assesses the recombinase activity of...
- 10
- 568
- 0
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf
... of AAP The pH was adjusted to 2.5, 8.0 and 11.5 and the samples were incubated at 37 °C, 50 °C and 70 °C Aliquots were taken at different time-points from each sample and analyzed by MALDI-TOF ... to the first h are shown Comparing the data obtained for particular temperatures (Fig 3), it can be seen that at 37 °C, the reaction was as fast at pH 2.5 as it was at pH 8.0 for the first h, although ... degradation of the protein was also observed after h of reaction Analysis of the data as a function of pH (Fig 3), showed that cyclization at pH 2.5 is faster when the temperature is increased, although...
- 9
- 704
- 0
Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc
... total RNA using a polytract mRNA isolation kit (Clontech) and first -strand cDNA synthesis was performed using a cDNA synthesis kit and an oligo (dT)15 primer from Amersham Pharmacia Biotech An A suum ... yield of mgÆL)1 of bacterial culture The rAsPPase was 99% pure as determined by SDS/PAGE analysis The observed molecular mass of rAsPPase corresponded well to the calculated mass of the AdR44 cDNA ... biochemical and functional characterization of a novel PPase from the important pathogenic roundworm A suum The deduced amino acid sequence of AsPPase shows significant similarity with animal/fungal...
- 13
- 691
- 0
Tài liệu Báo cáo khoa học: Functional dissection of the Schizosaccharomyces pombe Holliday junction resolvase Ydc2: in vivo role in mitochondrial DNA maintenance pptx
... Increasing amounts of total cellular DNA were loaded on the gels, as the hybridization signal in these samples was very low The general pattern remained the same: the 19.4-kb band was weak and a ... measured by quantitative dot blot hybridization of total DNA, as described in Materials and methods The relative amount of mtDNA was expressed as the ratio between mtDNAspecific and nuclear hybridization ... N-terminal region of Ydc2 (residues 1–35) contains a small putative DNA- binding SAP motif (after SAF -A/ B, Acinus and PIAS) associated with proteins involved in chromosomal organization and DNA repair...
- 11
- 575
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008