sample of a pr campaign plan
Tài liệu How to Plan a PR Campaign docx
... effectiveness of a PR campaign? Findout at How to Plan a PR Campaign. How to Plan a PR Campaign is an intensive two-dayseminar designed to show communicationsprofessionals how to plan, implement and ... should a really top notch PR plan contain? Whatdo the professionals include? This session takes youthrough all the critical stages of planning a PR campaign: ã The essential stages of planning a ... Write a PR Plan What should a PR plan look like? What should it say?This session explains the practicalities of sitting downand writing a full-blown PR campaign: ã How to write a PR plan a step-by-step...
- 4
- 669
- 0
Tài liệu Elements of a PR Plan pptx
... additionto the traditional array of print and broadcast sources, for dissemination of news and information. Every organization should have a program to stay intouch regularly with appropriate ... In addition to an ongoing public relations campaign it may be necessary to reach out to head off any negative publicity caused by lack of accurate information. Examples of appropriate use of ... transparencies. Press packagesmay include black-and-white photos and state that color material also isavailable via your Web site’s press section.Audio Tapes for RadioAudio tapes are rarely used, but can...
- 15
- 432
- 1
Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"
... Kaats GR was the principal investigator; he se-cured and audited all study data, conducted all of the statistical analyses, and contributed significantly to the preparation and submission of ... following all three plans had an increase in MAPC: Plan 1=1.30%, Plan 2=2.00%, and Plan 3=4.1%. Using a repeat-ed-measures t-test, the MAPC from baseline in all three Plans was significant (P=0.003, ... Subjects in all three plans had an increase in MAPC: Plan 1=1.20%, Plan 2=0.33%, and Plan 3=2.5%. Using a repeated measures t-test, MAPC in Plan 1 and 3 were significant (P=0.027 and P=0.002...
- 12
- 663
- 0
A LIST OF SOME PR FUNCTIONS
... advance for management of the crisis and the primary goal of this strategy should be the protection of participants, spectators and participating institutions. Having a strategy set in advance ... organizations and interest groups are "battling" for space or airtime. Press Releases Press releases help inform media of team-related news and events and can serve as a summary prior ... enter the data in and analyze if you have access to SPSS. If you do not have access to SPSS, the data can also be converted to other data analysis programs by your campus research department....
- 6
- 365
- 0
Tài liệu Advertising and PR campaign of Mobifone docx
... services providers seem to competed by value added services Advertising and PR campaign Advertising and PR campaign MediaMediaForForMCA service and MCA service and MobiFoneMobiFone WEAKNESSES ... Its automatically. MediaAds PR CreativeMarketing Strategy Creative Creative ForForMCA service and MCA service and MobiFoneMobiFone MARKETINGStrategies:ִUndertake TET promotion program: ... StrategyMarketing StrategyForForMCA service and MCA service and MobiFoneMobiFone PR campaign PR campaign ForForMCA service and MCA service and MobiFoneMobiFone STRENGTHS One of the...
- 45
- 460
- 0
Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc
... aa208 aa24 aaBamH34 aaStartStopXho1N-Pro Protease domainProtease domainCT - ex380 aa1IINP114 aa208 aaBamH134 aaStartStopXho1SS SSGSSSSN-Pro356 aaIIIMSTLFIISILLFLASFSYAMDISTIEYKYDKSSAWRTDEEVKEIYELWLAKHDKVYSGLVEYEKRFEIFKDNLKFIDEHNSENHTYKMGLTPYTDLTNEEFQAIYLGTRSDTIHRLKRTINISERYAYEAGDNLPEQIDWRKKGAVTPVKNQGKCGSCWAFSTVSTVESINQIRTGNLISLSEQQLVDCNKKNHGCKGGAFVYAYQYIIDNGGIDTEANYPYKAVQGPCRAAKKVVRIDGYKGVPHCNENALKKAVASQPSVVAIDASSKQFQHYKSGIFSGPCGTKLNHGVVIVGYWKDYWIVRNSWGRYWGEQGYIRMKRVGGCGLCGIARLPYYPTKAAGDENSKLETPELLQWSEEAFPLAIV A B66 ... rmErv-C+CT.Because Erv-C isolated from the latex of the sameplant does not show the CT-extension, the possibility19 aa 114 aa208 aa24 aaPre N-Pro Protease domainCT - ex365 aaH1INPro CT ex114 aa208 ... Nakamura K & Matsuoka K (1993) Protein targetingto the vacuole in plant cells. Plant Physiol 101, 1–5.10 Okamoto T, Yuki A, Mitsuhashi N & Mimamikawa T(1999) Asparaginyl endopeptidase...
- 13
- 759
- 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... QuikChange site-directedmutagenesis kit (Stratagene, La Jolla, CA, USA). PlasmidpET-1TK was used as template and Kleb(HtoA)fw(5Â-GCTTAGCCGCGCCGGCATTCG) and Kleb(HtoA)rv(5Â-CGAATGCCGGCGCGGCTAAGC) ... groups of HAPs are adapted todifferent habitats. To support plant growth, bacteriado not need to release phosphate as fast as the diges-tive tract of an animal host, where possible substratesmight ... similarity, the overall structure of Klebsiella phytase bears similar-ity to other histidine-acid phosphatases, such as E. coli phytase, glucose-1-phosphatase and human prostatic-acid phosphatase....
- 13
- 766
- 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... oxyhemeappeared at 540 and 579 nm. Then, a broad bandappeared at around 660 nm, and was maximal 9–12 minafter initiation of the reaction. The spectral features of the final reaction mixture were analogous, ... the axial heme ligand in ratheme oxygenase-1. Arch Biochem Biophys 317, 253–258.21 Chu GC, Katakura K, Tomita T, Zhang X, Sun D,Sato M, Sasahara M, Kayama T, Ikeda-Saito M &Yoshida T ... coli. PlantPhysiol 97, 1495–1401.40 Onda Y, Matsumura T, Kimara-Ariga Y, Sakakibara T,Sugiyama T & Hase T (2000) Differential interaction of maize root ferredoxin:NADP+oxidoreductase withphotosynthetic...
- 16
- 617
- 0
The impact of a cancer Survivorship Care Plan on gynecological cancer patient and health car provider reported outcomes (ROGY Care): study protocol for a pragmatic cluster randomized controlled trial potx
... status, and clinical variables such as cancerstage at diagnosis, time after diagnosis, and initial treat-ment. All measures will be collected at the beginning of the trial, and at 6, 12, 18 and ... Providinginformation that i s congruent with a patient ’sneedsatthat particular time is an important determinant forpatient satisfaction and affects health-related quality of life (HRQoL) and anxiety and ... sum-marize characteristics of both hospitals and patients.Characteristics of patients (i.e ., age, type of cancer,stage, treatment, so cio-economic status, marital statu s,educational level,...
- 8
- 786
- 0
Subjective memory complaints and cognitive performance in a sample of healthy elderly pot
... Sessentaidosossemcompro-metimentocognitivo(39mulherese21homens),comidadede69,96,3anosecomescolaridadede8,55,5anos,foramincluớdosnoestudo.TodosforamsubmetidosaoMini-ExamedoEstadoMental(MEEM)eEscaladeDepressóodeCornellparaexclusóo,respectivamente,decomprometimentocognitivoglobalededepressóo.TambộmresponderamaoMAC-Q,questionỏrioelaboradoparaavaliaraimpressóosubjetivadofuncionamentodamemúria.Posteriormente,elesforamsubmetidosaostestesextensóodedớgitosemordemdiretaeinversa,BateriaBrevedeRastreioCognitivoeBateriadeAvaliaỗóoFrontal.Resultados: ... 2008;2(1):42-45Memory loss is one of the most common complaints arising in consultations with elderly people, being reported by 25% to 50% of these individuals.1 However, whether these subjective memory complaints (SMC) are related to objective memory deficits or to subsequent development of dementia, remains a matter of debate. A recent review found that SMCs are not consistently associated with current cognitive impairment, but rather are associated with a greater risk of future cognitive de-cline.2 Indeed, the diagnosis of mild cognitive impairment (MCI), which entails an increased likelihood of conversion to dementia, demands the existence of SMCs, preferably confirmed by an informant.3High age, female gender and low educational level are generally associated with a higher prevalence of memory complaints.1 In an autopsy study, SMCs were found to be related to the presence of Alzheimer’s disease (AD) pathol-ogy in elderly with and without dementia, suggesting that memory complaints in older persons may be a sign of self awareness of a degenerative process.4However, SMCs might also be related to depression and some personality traits, such as neuroticism.2 It is also pos-sible that these complaints vary according to the culture of the people studied. In a recent Brazilian study, Minett et al. found that subjects with and without SMCs performed similarly in a series of cognitive tests, although the former had higher scores on the Geriatric Depression Scale.5The present study aimed to further investigate this topic in a group of cognitively healthy Brazilian elderly subjects which were divided into two subgroups according to the presence of SMCs and submitted to brief cognitive tests.MethodsSixty cognitively intact elderly individuals (39 females and 21 males), aged 69.9±6.3 years (ranging from 60 to 91 years), and with mean educational level of 8.5±5.5 years (ranging from 1 to 20 years), were included in the study. These individuals were family caregivers of demented pa-tients followed at the Behavioral and Cognitive Neurology Unit of the Faculty of Medicine of the Federal University of Minas Gerais, in Belo Horizonte (MG), Brazil, and also volunteers recruited from the community.Inclusion criteria were absence of neurological or psy-chiatric diseases according to a clinical interview, absence of depression (see below), and no use of benzodiazepines, antidepressants or neuroleptics. All participants were submitted to the Mini-Mental State-Examination (MMSE)6,7 and to the Cornell scale of depression.8,9 Performance on the MMSE was adjusted for educational level and had to be greater than or equal to 21 for 1-3 years of schooling, greater than or equal to 24 for 4-7 years and greater than or equal to 26 for individuals with 8 or more years of schooling.10 Scores on the Cornell scale of depression had to be less than or equal to 7 points in order to rule out depression.8Cognitive evaluation was carried out with the follow-ing tests: the Brief Cognitive Screening Battery (BCSB)11,12, digit span forward and backward and the Frontal Assess-ment Battery (FAB).13,14 The BCSB includes a memory test of 10 simple figures and yields different scores, namely: incidental and immediate memory, learning, delayed recall and recognition.15,16 The battery also includes a category fluency test (animals per minute) and clock drawing and has proven very sensitive in the diagnosis of mild AD.12 The FAB is a brief diagnostic instrument for the assessment of executive functions in patients with suspected frontal lobe syndrome.13All individuals were given a structured self-report memory questionnaire, the MAC-Q.17 This questionnaire was devised to assess age-related memory decline. It is composed by six questions related to memory function-ing in everyday situations (e.g., to remember a telephone number that he/she uses at least once a week) in which the subject is asked to compare and rate his/her current ability to when he/she was 40 years’ old. The total score on the MAC-Q ranges from 7 to 35, where greater scores in-dicate subjective memory loss. Scores greater than or equal to 25 have been found to be suggestive of age-associated memory impairment. Accordingly, in the present study, the individuals were divided into two groups: absence of SMCs (MAC-Q scores <25) and presence of SMCs (MAC-Q scores ≥25). The performance of the two groups on the different cognitive tests was compared.One of the authors administered the MMSE, the Cor-nell scale and the MAC-Q. Subsequently, the other inves-tigator, blinded to the subjects’ results for these three mea-sures, administered the cognitive evaluation.Descriptive analysis of the data and statistical compari-sons between the performances of the two groups on the different cognitive tests were carried out with MedCalc software. Student’s t-test was used for comparison of age, educational level and MMSE scores, as well as for the results of the other cognitive tests (digit span, BCSB and FAB). Chi-square was employed for comparing gender distribu-tion of the two groups. Level of significance was set at 0.05. The study was approved by the Research Ethics ... Sessentaidosossemcompro-metimentocognitivo(39mulherese21homens),comidadede69,96,3anosecomescolaridadede8,55,5anos,foramincluớdosnoestudo.TodosforamsubmetidosaoMini-ExamedoEstadoMental(MEEM)eEscaladeDepressóodeCornellparaexclusóo,respectivamente,decomprometimentocognitivoglobalededepressóo.TambộmresponderamaoMAC-Q,questionỏrioelaboradoparaavaliaraimpressóosubjetivadofuncionamentodamemúria.Posteriormente,elesforamsubmetidosaostestesextensóodedớgitosemordemdiretaeinversa,BateriaBrevedeRastreioCognitivoeBateriadeAvaliaỗóoFrontal.Resultados: Vinteseteidosostiveramescores<25noMAC-Qeforam,portanto,classicadoscomonóotendoqueixas,enquanto33tiveram>25pontosnoquestionỏrioeforamconsideradoscomotendoqueixas.Nóohouvediferenỗasentreosdoisgruposemrelaỗóoidade,gờnero,escolaridadeepontuaỗừesnoMEEM.Acomparaỗóoentreodesempenhodosidososcomesemqueixasnosdiferentestestesnóoreveloudiferenỗassignicativas,emboratenhasidoobservadatendờnciaparaqueossemqueixastivessemmelhordesempenhodememúriaincidental.Conclusừes:...
- 4
- 534
- 0
Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf
... L, Hamid Q & Elias JA (2004) Acidicmammalian chitinase in asthmatic Th2 inflammationand IL-13 pathway activation. Science 304, 1678–1682.4 Kasprzewska A (2003) Plant chitinases ) regulation ... equal amounts of (GlcNAc)3and (GlcNAc)2;the 80 : 20 anomeric ratio of the products indicatesthat cleavage after sugar 2 or sugar 3 occurs approxi-mately equally often.StructureThe overall ... Bio-Rad Protein Assay Kit (Bio-Rad, Hercu-les, CA, USA) with BSA as a standard.Analyses of the specific activity against chitooligosaccha-rides were performed in 100 lL reaction mixtures con-taining...
- 12
- 399
- 0
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx
... [e.g.cerato-platanin of Ceratocystis fimbriata f. sp. platani,Snodprot1 of Phaeosphaeria nodorum and Sp1 of Leptosphaeria maculans) or human allergens and path-ogenesis-related proteins (As-CG of ... several proprietary andpublic genomic databases using a tailor-made bioinformat-ics facility. The mascot search was run against all proteinsand DNA sequence information from public databasesV. ... conidia andhyphae of Ceratocystis fimbriata f. sp. Platani. FEMSMicrobiol Lett 233, 341–346.25 Pazzagli L, Cappugi G, Manao G, Camici G, Santini A & Scala A (1999) Purification, characterization,...
- 14
- 494
- 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt
... (ATGGAGAACTCAGTGACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAGGTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACTATCAGCAGAAGCAATGTGGTGATA) and 70b R2(TTACTGAGATGTCTTGTTCTTGGAAATGT) primersfor atrpa70b. As a control, A. thaliana ... (TGTAACCGAGATGGTCGGCAAC) and AtRPA7 0a- 3Â (AACAGTCATCTTCACTCTTTGT); AtRPA70b-5Â (TTCAACTTTGTACCCATTGAT) and AtRPA70b-3Â (TTCACCGCCATTATATACCTTA). These primers were used toobtain a fragment of 722 bp ... (AtRPA7 0a and AtRPA70b) A. thaliana was used for genetic analysis of the functions of OsRPA7 0a and OsRPA70b because it has closely rela-ted homologs (AtRPA7 0a and AtRPA70b, respectively)and because...
- 12
- 588
- 0
Báo cáo khoa học: Purification of a plant nucleotide pyrophosphatase as a protein that interferes with nitrate reductase and glutamine synthetase assays pdf
... (NR) was highly purified from cauli-flower (Brassica oleracea var. botrytis) extracts. The finalpreparationcontainedanacyl-CoAoxidaseandasecondprotein of the plant nucleotide pyrophosphatase family. ... theamounts and concentrations of ATP and NADH used in standard GSand NR assays, respectively. Data are presented as mean ± SEM.CofactorAMP generated(nmol)% cofactor hydrolysedto AMPNone 0.4 –ATP ... oleracea var. botrytis) extracts.The final preparation contained an acyl-CoA oxidase and a second protein of the plant nucleotide pyrophosphatasefamily. Nucleotide pyrophosphatases belong to a family...
- 7
- 457
- 0
Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf
... histogram represent the AtZFP11 expressionlevels adjusted to a- tubulin across all samples. Units are given as number of AtZFP11 moleculesặ lg)1 of total RNA. Data representan average of three ... adjacent to theATG start codon and SacI downstream of the TAA stopcodon for easy cloning in the forward and reverse primers,respectively (forward, 5Â-ctc gag ATG AAG AGA ACACAT TTG GCA-3Â; ... (Promega Corporation). Twenty microli-ters of protoplast lysate was loaded into each well of a 96-well plate, and luciferase activity was measured in a plateV. S. Tavva et al. Improvement of EcR gene...
- 16
- 454
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008