sacral nerve root stimulation for the treatment of pelvic and rectal pain
Báo cáo y học: " Pregnancy and delivery while receiving vagus nerve stimulation for the treatment of major depression: a case report" pot
... Inc., collected the data for this pilot study and encouraged the authors to submit this case report to help increase the understanding of VNS therapy and pregnancy References Andersson L, Sundstrom-Poromaa ... DSM-IV diagnosis of unipolar depression, was enrolled in the acute and long-term phases of the pilot study of VNS therapy for TRD At acute-phase study entry, she was noted to be obese and to have ... studies of patients with TRD, there have been no studies of the use of VNS therapy among pregnant patients A report of eight pregnancies in patients receiving VNS therapy for pharmacoresistent epilepsy...
- 7
- 453
- 0
Báo cáo y học: "Deep transcranial magnetic stimulation for the treatment of auditory hallucinations: a preliminary open-label study" pptx
... is, twitching of the contralateral abductor policis brevis (APB) muscle in the hand) The coil was then moved 4.5 cm posteriorly and 6.5 cm laterally towards the left shoulder of the patient In ... study session, and post treatment within 24 h of the last session, using the Auditory Hallucinations Rating Scale (AHRS) developed by Hoffman et al [4], the Scale for the Assessment of Positive ... (SAPS) and Scale for Assessment of Negative Symptoms (SANS) (with standard error of mean (SEM)) day before treatment (baseline), day after last session (end of treatment) , week after last session and...
- 6
- 484
- 0
Báo cáo khoa học: "Prior surgical intervention and tumor size impact clinical outcome after precision radiotherapy for the treatment of optic nerve sheath meningiomas (ONSM)" docx
... Kuhn and her team of technicians for excellent patient care Authors’ contributions SC, JD and SR treated the patients SA, SR and SC collected the data SC and SA evaluated the dataset and performed ... new headaches, and three of recurrent hyperlacrimation of the irradiated eye, one with change of taste perception None of the patients developed dysfunctions of the pituitary gland, neuropathy, ... returned in 32 out of the 40 patients (80%) The median age at the time of radiotherapy was 44 years (range 17-83 years) The tumor manifestation was on the right eye in 16 patients and on the left eye...
- 6
- 327
- 0
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique
... 100% relief of their pain in 86% of the patients with a median relief period of months The range of relief varied from zero days to up to 13 months for the facet injection group None of the lumbar ... median period of pain relief being months The range of relief for the radiofrequency group was from zero days to 16 months for all 26 patients who underwent the radiofrequency procedure Of the 14 patients ... dorsal root axons should be incapable of re-innervating the joint In this study we investigate the long-term efficacy of facet debridement for the treatment of chronic back pain originating in the...
- 4
- 599
- 0
Báo cáo y học: "Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic radiculopathy: report of 12 case"
... Conflict of Interest The authors have declared that no conflict of interest exists References Kunogi J, Hasue M Diagnosis and operative treatment of intraforaminal and extraforaminal nerve root compression ... vascular and neural structures increases the risk of adverse events with invasive approaches Open surgical correction is the current standard of care for foraminal stenosis of cervical and lumbar ... Pituitaries and kerrisons were then used to remove bulk tissues and bone to open up the spinal canal A standard burr with a 6mm bit was used to remove bone and smooth the bony edges of the opening...
- 3
- 506
- 0
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
... laboratory of UT at 4oCstored Then, each of the samples were divided into two One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20oC Another was for FISH ... down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the ... general, the higher concentration of primers can lead to the formation of primer dimers Also, the cost of the chemicals should be minimized if the same quantitativeness can be achieved The results...
- 8
- 572
- 0
Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater
... (2008ZX07103-001 and 2008ZX07316-002), and the Anhui R&D Key Project (07010301022 and 08010302109) for the partial support of this study REFERENCES Standard Methods for the Examination of Water and Wastewater ... technical feasibility of this process was demonstrated The effects of recycle ratio, HRT of the regeneration tank, HRT of the adsorption tank and SRT of the system were evaluated The removal efficiency ... with the increased HRT of the adsorption tank From an engineering application point of view, the appropriate operational parameters of the recycle ratio, HRT of the regeneration tank, HRT of the...
- 8
- 686
- 0
Tài liệu Bevacizumab and cetuximab for the treatment of metastatic colorectal cancer docx
... from data in the RCT The survival of patients receiving ASC/BSC was calculated from the survival of the patients in the cetuximab monotherapy arm of the RCT The data from the monotherapy arm NICE ... guide for healthcare professionals Information for people with metastatic colorectal cancer and their carers (‘Understanding NICE guidance’) Details of all the evidence that was looked at and other ... considered evidence on the nature of the condition and the value placed on the benefits of bevacizumab and cetuximab by people with metastatic colorectal cancer, those who represent them, and clinical...
- 34
- 853
- 0
Hydroxyurea for the Treatment of Sickle Cell Disease docx
... What are the short- and long-term harms of hydroxyurea treatment? What are the barriers to the use of hydroxyurea treatment (and other therapies) for patients who have sickle cell disease and what ... reviewer reconciled the results of the first two reviewers; for the other study designs, the results of the two reviewers were averaged The overall score was the percentage of the maximum possible ... 1967 for the treatment of neoplastic diseases 14 In subsequent years, clinical trials demonstrated the efficacy of this drug for the treatment of CML, psoriasis, and polycythemia vera Although there...
- 298
- 1,113
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... but their development is the result of an aberrant shift in activity of tau kinases and phosphatases [3] Thus, although targeting plaques and NFTs may ameliorate some of the consequences of AD and ... function as a counter ion for the high concentrations of glutamate present and quenches the response of the NMDA receptor [36] Like Cu and Fe, considerable data indicates a loss of Zn homeostasis in ... hyperphosphorylated, and hyperphosphorylated tau is the form that aggregates in NFTs [71] The loss of functional tau from the microtubule network can be compensated for by the other microtubule-associated...
- 9
- 634
- 0
Báo cáo khoa học: A guide to taming a toxin – recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer ppt
... against the inclusion of lysine residues in the protein sequence of the A fragment but not the B fragment of PE Because only the A fragment must traffic to the cytosol for activity, the lack of lysine ... engineered into the framework region of the Fv [25–27] A cytotoxic fragment of PE can be inserted at the C-terminus of one of the two Fv polypeptide chains (Fig 1) The generation and production of PE-based ... agent for the elimination of cells have become purposeful strides to generate the immunotoxins of today and, we anticipate, the medicines of tomorrow Advances in our understanding of PE and its...
- 18
- 528
- 0
Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc
... evidence for the optimal period of treatment and number of treatments? We found evidence for the efficacy of shorter treatment protocols than the 4–6 months recommended by the ICS The basis of the ... the differences in outcome The expertise of health professionals may vary and also the quantity and quality of the educational information about the condition and PFM function The impact of these ... exercise dosage is the critical factor is unclear The optimal length of treatment and the number of treatment episodes could be useful information for the marketing of physical therapy for SUI Some...
- 28
- 738
- 0
Best Practice Policy Statement on Cryosurgery for the Treatment of Localized Prostate Cancer pptx
... of Directors of the AUA Funding of the Panel and of the PGC was provided by the AUA, although Panel members received no remuneration for their work Each member of the PGC and of the Panel furnished ... potential of thermal injury to this muscle The thermosensor is introduced through the perineal skin and advanced until the impression of the tip of the thermocouple can be seen in the sphincter The placement ... Cryosurgery for the Treatment of Localized Prostate Cancer The supporting systematic literature review and the drafting of this document were conducted by the Cryosurgery for Treatment of Localized...
- 51
- 417
- 0
SYNTHESIZE AND INVESTIGATE THE CATALYTIC ACTIVITY OF THREE-WAY CATALYSTS BASED ON MIXED METAL OXIDES FOR THE TREATMENT OF EXHAUST GASES FROM INTERNAL COMBUSTION ENGINE
... choice and loading of the NM is a compromise between the required efficiency of the converter and the market price of the NM However, the application of noble metals for the treatment of exhaust ... are formed in adsorption of reactant molecules on the semi-conducting surface; the formation of these is a function of the electronic properties of the solid, and the structure and kind of bonds ... begins with the adsorption of CO and O2 on the Nguyen The Tien 29 Synthesize and investigate the catalytic activity of three-way catalysts based on mixed metal oxides for the treatment of exhaust...
- 117
- 376
- 0
báo cáo hóa học:" Identifying alemtuzumab as an anti-myeloid cell antiangiogenic therapy for the treatment of ovarian cancer" pdf
... overall survival of treated animals (Figure 6D) These results confirm the anti-tumor activity of anti-VLC therapy, as observed by others, and further support the use of anti-CD52 therapy in humans ... absence of complement; (1) In the presence of Alemtuzumab and heat inactivated sera, the majority of VLC are viable Annexin V (-) and PI (-) cells In contrast, in the presence of Alemtuzumab and ... analyzed for VLC by FACS Treatment of Flank Tumors 20 × 106 ID8-VEGF cells were injected subcutaneously into the flanks of C57BL6 mice and the tumors were allowed to grow for two weeks The animals...
- 14
- 728
- 0
báo cáo hóa học:" Recent progress towards development of effective systemic chemotherapy for the treatment of malignant brain tumors" docx
... following the intravenous infusion of the Gd-dendrimer (T1), and the in vitro measurement of the molar relaxivity (r1) of the Gd-dendrimer, which is the proportionality constant for conversion of Gd ... panels D and E)[73] This finding is consistent with the formation of new anatomic defects within and between endothelial cells of the BBB following disruption of the overlaying glycocalyx On the basis ... include the administration of drugs intra-arterially to maximize first-pass drug delivery across the BBTB [44-46], and the temporary opening of the junctions between endothelial cells of the BBTB...
- 14
- 492
- 0
Báo cáo hóa học: "Adaptive robot training for the treatment of incoordination in Multiple Sclerosis" doc
... affected hand The position of the seat was also adjusted in such a way that, with the cursor pointing at the center of the workspace, the elbow and the shoulder joints were flexed about 90° and 45°, ... between T0 and T1, and second, between T2 and T3) and treatment (EE or ER) as fixed factors, subject as random factor and the baseline value at the start of the relevant period (i.e., T0 and T2) ... to reduce the observed variation between the two groups of subjects caused not by the treatment itself but by variation of the clinical scale at the beginning of the therapy To test the overall...
- 11
- 596
- 0
báo cáo hóa học:" Is tension band wiring technique the "gold standard" for the treatment of olecranon fractures? A long term functional outcome study" docx
... improve the biomechanical properties of the technique [20] Rowland and Burkhart [21] gave an emphasis on the mathematical need to put the transverse hole for the figure -of- eight tension band wire ... minimal loss of physical capacity The technique remains the "gold standard" for the treatment of displaced and minimally comminuted olecranon fractures despite the introduction of new Page of (page ... non-union, malunion and ulnar nerve palsy could compromise the effect of operative treatment in up to 10% of cases [1113] Moreover, the subcutaneous placement of K-wires and their potential migration...
- 6
- 492
- 0
báo cáo hóa học:" Long-term follow-up on the use of vascularized fibular graft for the treatment of congenital pseudarthrosis of the tibia" pdf
... one was for the initial trial of VFG, and the other was for the second trial of VFG after failure of bone consolidation in ipsilateral VFG Patients The mean age of the patients at the time of VFG ... using the MannWhitney U-test for quantitative data of the term of bone consolidation and leg-length discrepancy, and using Fisher's exact test for qualitative data of the existence of ankle pain ... [14], and degenerative changes in the ankle because of the ankle valgus deformity and the intramedullary rod passing through the ankle joint is considered to be the cause of the ankle pain [14-16]...
- 7
- 502
- 0
báo cáo hóa học:" Two levels above and one level below pedicle screw fixation for the treatment of unstable thoracolumbar fracture with partial or intact neurology" pot
... bending of the hardware, and segmental kyphosis after a caudad screw in the lumbar construct broke And they noted that untreated anterior instability, and pre-stressing of the screws when the rods ... drafting the manuscript and designing of data and revising it critically, KCN has contributed in acquisition of data and analysis and interpretation of data, and JHY has contributed in acquisition and ... through the rod pusher to bring the vertebra back to the rod Gentle distraction at the level of the fracture followed, restoring tension to the posterior longitudinal ligament (ligamentotaxis) and thereby,...
- 6
- 519
- 1
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008