0

rubella also known as german measles or 3 day measles the rubella vaccine is usually given as a combined measles mumps rubella shot so you may remember the shot being called mmr

Báo cáo khoa học:

Báo cáo khoa học: " A geminiviral amplicon (VA) derived from Tomato leaf curl virus (ToLCV) can replicate in a wide variety of plant species and also acts as a VIGS vector" pps

Báo cáo khoa học

... USA) and the following primers: Forward: 5'ATGAGCTCATGGCAAGTAAAGGAGAAGAAC -3' , and Reverse: 5'-CGGGATCCGAGCTCTTAGAGTTCGTCGTGTTTG -3' The amplified fragment was cloned in the forward orientation ... terminator was PCR amplified from the pRT100 vector (using the primers: Forward: 5'-AAGCTTAACATGGTGGAGCACGACACTC -3' , and Reverse 5'-GAATTCGTCACTGGATTTTGGTTTTAG -3' ) and was cloned in the pCAMBIA 139 1Z ... PCNA fragment (30 0 bp) was amplified from it using the primers Forward: 5'-ACGGATCCGTTCTAGAATCGATTAAGGATCTGG -3' , and Reverse: 5'-GGGGATCCCCATTAGC TTCATCTCAAAATCAG -3' The primers were designed based...
  • 13
  • 428
  • 0
Manhood Perfectly Restored, by Unknown This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg pptx

Manhood Perfectly Restored, by Unknown This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg pptx

Sức khỏe giới tính

... it by case after case, that by no other method can such rapid and perfect restoration of the organs to a natural and healthy state be obtained as by this Some of the very worst and apparently ... developed organs sometimes dates from birth, but in most cases it is caused by self-abuse at a time when the person is growing In any case, Seminal weakness and Wasted or Misshapen Parts go together as ... Professors Claude Lallemand and Jean Civiale The medical as well as civil honors conferred upon them by their country and their medical brethren, great as they were, could never half repay them for...
  • 371
  • 1,077
  • 0
Outlines of Greek and Roman Medicine, by James Sands Elliott This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of docx

Outlines of Greek and Roman Medicine, by James Sands Elliott This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of docx

Sức khỏe giới tính

... of Cato" (the Censor, who was born in 234 b.c.), we read of a Roman ambassador who was sent to the King of Bithynia, in Asia Minor, and who had his skull trepanned The first regular doctor in ... instituted a historical section The material I have used in this book has been gathered from many sources, and, as far as possible, references have been given, but I have sought for, and taken, information ... declamatory, the fact remains that the substance of this description is in accordance with the facts of history Never until the Christian era was any thought given to the regular care of the...
  • 425
  • 659
  • 0
The Eugenic Marriage, Vol 2 (of 4), by W. Grant Hague This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Pro pptx

The Eugenic Marriage, Vol 2 (of 4), by W. Grant Hague This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Pro pptx

Sức khỏe giới tính

... means The first symptoms, or what is known as the initial lesion of syphilis, is the chancre The Chancre is a small, hard tumor, or it may be a small ulcer with a hard base, or it may simply appear ... other of these diseases When it is remembered that these diseases are not merely temporary incidents, but that they may be regarded as practically incurable in the vast majority, because of antagonistic ... female and he will acquire a disease as a result Inasmuch as it has been asserted that practically every boy has been addicted to self-abuse at some time, and that eighty per cent of all males,...
  • 634
  • 1,044
  • 0
The Healthy Life, Vol. V, Nos. 24-28, by Various This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg L ppt

The Healthy Life, Vol. V, Nos. 24-28, by Various This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg L ppt

Sức khỏe giới tính

... from a plain sack into a rucksack or back-sack Get or make as many good large strong ones as you have shoulders in the party to carry them Have them made of a waterproof canvas, green or brown, ... a large ration of meat just as well as with a large ration of alcohol The one leads to the other, meat leads to alcohol, alcohol to meat Taking any stimulant eventually leads to a call for other ... Never the knapsack I am almost ashamed to say this, because as far as my knowledge goes the knapsack is now obsolete It may be, however, that it lingers here and there If you see one, buy it for a...
  • 815
  • 2,061
  • 0
Báo cáo y học:

Báo cáo y học: "Collagen type II (CII)-specific antibodies induce arthritis in the absence of T or B cells but the arthritis progression is enhanced by CII-reactive T cells" ppsx

Báo cáo khoa học

... with the monoclonal antibodies did not alter the acute phase of antibody-mediated disease into a chronic disease course, suggesting the importance of other cellular mediators in the pathogenesis ... for disease development [33 ], similar to antiglucose-6-phosphate isomerase antibody-induced disease [34 ] The observed enhancement of arthritis in the T cell and B cell singly deficient mice also ... Österlund Foundations, the Swedish Association against Rheumatism, the Science Research Council and the Swedish Foundation for Strategic Research References Trentham DE, Townes AS, Kang AH: Autoimmunity...
  • 7
  • 434
  • 1
Tài liệu Module 3: DHCP as a Solution for IP Configuration pptx

Tài liệu Module 3: DHCP as a Solution for IP Configuration pptx

Hệ điều hành

... prepared to discuss your answers with the class Scenario An organization has decided to restructure an existing DHCP-based network You are assigned the task of evaluating how to enhance the availability ... lease renewal Modifying the lease adjusts the time before DHCP automatically makes the IP address available to other DHCP Clients if the original lease is not renewed For example, decreasing the ... Emphasize that you can use multiple servers to enhance the performance of the DHCP solution • Emphasize that you can modify IP address lease lengths so that the addresses can be available for...
  • 48
  • 394
  • 0
Epistles from Pap: Letters from the man known as ''''The Will Rogers of Indiana'''' doc

Epistles from Pap: Letters from the man known as ''''The Will Rogers of Indiana'''' doc

Cao đẳng - Đại học

... over the girl graduates with a view to bidding them admission to the several sororities Joan was invited to a great many among them Kappa Alpha Theta Kappa Alpha Theta was founded at DePauw probably ... was the bachelor scion of perhaps the most distinguished and aristocratic families in Indiana at that time CHAPTER II 23 The Indianapolis Star and other newspapers had a field day covering the ... them a chance to give the "once over" on what they were reasonably expected to cast their franchises for State Senator for this Fall As I told you some time ago, I'm a candidate for State Senator...
  • 121
  • 445
  • 0
TEFL/TESL: TEACHING ENGLISH AS A FOREIGN OR SECOND LANGUAGE pot

TEFL/TESL: TEACHING ENGLISH AS A FOREIGN OR SECOND LANGUAGE pot

Kỹ năng viết tiếng Anh

... approach Communicative approach Background The emphasis is placed on using the target language to accomplish a function such as complaining, advising, or asking for information Attention is also ... found You may already have training in the teaching of English, or your specialty may be in another technical area Regardless of whether you are an old hand or a newcomer, this manual was written ... Communicative language teaching, on the other hand, places more emphasis on being understood, rather than being taken for a native speaker of English This has implications for your classroom Your...
  • 156
  • 652
  • 2
THE GUIDE TO CASHING SAVINGS BONDS - (Formerly known as the Identification Guide for Cashing United States Savings Bonds) pptx

THE GUIDE TO CASHING SAVINGS BONDS - (Formerly known as the Identification Guide for Cashing United States Savings Bonds) pptx

Ngân hàng - Tín dụng

... to the Document tab Go to the Document tab Personal identification based on a casual acquaintance isn’t reliable, for example, a brief landlord-tenant relationship or identification made of patrons ... Make adequate notations about the identification used It is very important to make a notation of the identification you accepted The notation may be on the bond/note or a separate record The notation ... Don’t cash the bond The customer must obtain a certified death certificate for each person named on the bond Is the name on the death certificate(s) the same as the name(s) on the bond? Go to the...
  • 32
  • 424
  • 0
Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc

Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc

Báo cáo khoa học

... mass forms Parallel analysis of the supernatants revealed a positive signal starting at 60 of chase and having a molecular mass (82 kDa) consistent with a fully mature form This band was not ... molecular mass form during the 180 of chase On the other hand, an 80 kDa mature form progressively appeared and accumulated in the supernatants at chase times of 60–120 Because at T0 only the 70 kDa ... Immunoprecipitation and SDS/PAGE Materials and cell lines The mAbs V.1 and V.5 against GPV, ALMA.12 against GPIba, ALMA.16 against GPIX and RAM.1 against GPIbb, were developed in our laboratory [19]...
  • 7
  • 363
  • 0
Public management as a social science or a business subject in a   luận án tiến sỹ của tác giã nước ngoài liên quan đến đề tài về kiểm toán

Public management as a social science or a business subject in a luận án tiến sỹ của tác giã nước ngoài liên quan đến đề tài về kiểm toán

Tiến sĩ

... there was a drastic shift in focus The South African society had moved from apartheid racial and ethnic discrimination to a more egalitarian, non-discriminatory society At the same time, cognizance ... responsible for the administration and presentation of the public management academic programme, which at that time was the National Diploma and Advanced Diploma The Public Management academic programme ... sector bodies as well as the private sector Ballard has successfully supervised nineteen Master’s degree candidates in the Public Management and Business Administration disciplines and has also...
  • 25
  • 498
  • 0
opportunities global the annual report is also published in german  annual report 2000 holcim ltd

opportunities global the annual report is also published in german annual report 2000 holcim ltd

Kinh tế - Thương mại

... l’Oriental S .A Alpha (Pty) Limited Guinea Tanzania Ciments de Guinée Tanga Cement Company Ltd Ivory Coast Madagascar Société Ivorienne de Ciments et Matériaux Macoma Burkina Faso La Réunion Société ... Increase in cash and cash equivalents (A + B + C) Total reserves (B1 + B2 + B3) 32 6, 430 Increase in cash and cash equivalents Effects of exchange rate movements Cash and cash equivalents as at ... for Sustainable Development Further- embraced for many years As a member of sess and analyze the global cement indus- and also play a major role in waste dis- more,“Holdercim” in Brazil is the...
  • 62
  • 312
  • 0
Báo cáo toán học:

Báo cáo toán học: "The number of graphs not containing K3,3 as a minor" pptx

Báo cáo khoa học

... can state the theorem as a consequence of Wagner’s theorem in the following way Theorem 3. 2 ([16], see also Theorem 1.2 of [14]) A graph has no minor isomorphic to K3 ,3 if and only if it can be ... of maximal K3 ,3 -minorfree graphs Roughly speaking his theorem states that a maximal graph not containing − K3 ,3 as a minor is formed by gluing planar triangulations (different from K5 ) and the ... obtained from K3 ,3 by adding one edge) as a minor For this we use the following recent result from [4] + Theorem 4.1 A 3- connected graph not containing K3 ,3 as a minor is either planar or isomorphic...
  • 20
  • 248
  • 0
Báo cáo y học:

Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps

Báo cáo khoa học

... these situations, such as that reported in Figs and 5, the importance of maintaining the local level of IL-1Ra became dramatically apparent, as were the advantages of gene transfer as a means of ... chronic articular disease Indeed, IL-1Ra gene therapy has demonstrated impressive efficacy in animal models of RA and OA, and a phase I human trial has recently confirmed that the human IL-1Ra cDNA ... synthesis of IL-1β over time Discussion R306 For the treatment of arthritis, gene therapy has the theoretical advantage over protein therapy of sustained delivery of the therapeutic product to a...
  • 9
  • 421
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Combination therapy with docetaxel and S-1 as a first-line treatment in patients with advanced or recurrent gastric cancer: a retrospective analysis" docx

Báo cáo khoa học

... 10:10 63- 1069 Koizumi W, Narahara H, Hara T, Takagane A, Akiya T, Takagi M, Miyashita K, Nishizaki T, Kobayashi O, Takiyama W, Toh Y, Nagaie T, Takagi S, Yamamura Y, Yanaoka K, Orita H, Takeuchi ... Ninomiya M, Takakura N, Hirabayashi N, Takiyama W, Sato Y, Todo S, Terashima M, Gotoh M, Sakamoto J, Nishiyama M: Phase II study of docetaxel and S-1 combination therapy for advanced or recurrent gastric ... Norman A, Mansi J, Nicolson M, Hickish T, Nicolson V, Nash A, Sacks N, Ford H, Carter R, Hill A: A phase II study in advanced gastro-esophageal cancer using epirubicin and cisplatin in combination...
  • 7
  • 407
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Integrated-boost IMRT or 3-D-CRT using FET-PET based auto-contoured target volume delineation for " pps

Báo cáo khoa học

... 90(1):72-77 Tanaka M, Ino Y, Nakagawa K, Tago M, Todo T: High-dose conformal radiotherapy for supratentorial malignant glioma: a historical comparison Lancet Oncol 2005, 6(12):9 53- 960 Irish WD, Macdonald ... between mean doses and EUD's in the IMRT- and 3D-CRT-plans Values are expressed as mean ± standard deviation or as mean value and the range of the values All p-values reported are two-sided and p ... involved in acquisition of data and revised the manuscript CA has been involved in acquisition of data and revised the manuscript HJK has been involved in acquisition of data and revised the manuscript...
  • 12
  • 332
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a binding protein for a 68-kDa Bacillus thuringiensis parasporal protein cytotoxic against leukaemic cells" potx

Báo cáo khoa học

... cell-killing activity is associated with some non-insecticidal Bt isolates resulting in a new category of Bt parasporal protein called parasporin Parasporins are defined as bacterial parasporal proteins ... Cry41Aa (parasporin -3) and Cry45Aa (parasporin-4) also with selective cytotoxic activities against cancer cells [5-7] Recently two more parasporin (PS5Aa1 and PS6Aa1) were added in the parasporin ... that there may be a role for GAPDH in the mode of action for Bt18 parasporal protein It is interesting to note that Bt18 parasporal protein act like parasporins, as these proteins are non-haemolytic...
  • 11
  • 366
  • 0
Báo cáo y học:

Báo cáo y học: "Off-pump or Minimized On-pump Coronary Surgery - Initial experience with Circulating Endothelial Cells (CEC) as a supersensitive marker of tissue damage" pptx

Báo cáo khoa học

... KF participated in the study concept and data analysis, revised the manuscript and approved the final manuscript MS participated in data analysis, revised the article and approved the final manuscript ... manuscript AS collected all data, participated in the analysis of data, revised the article and approved the final manuscript TW (senior author) approved the concept of the study, revised the article and ... 90: 1 134 -41 26 Takagi H, Tanabashi T, Kawai N, Umemoto T Off-pump coronary artery bypass sacrifices graft patency: meta analysis of randomized trials J Thorac Cardiovasc Surg 2007; 133 : e2e3 27...
  • 29
  • 344
  • 0
Báo cáo y học:

Báo cáo y học: "Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function" ppsx

Báo cáo khoa học

... Recently, MATR3 has also been involved in the DNA damage response [35 ] Hence, MATR3 may be at the crossroad of several nuclear processes, serving as a platform for the dynamic assembly of functional ... MATR3 siGENOME SmartPool (UAGAUGAACUGAGUCGUUA, GACCAGGCCAGUAACAUUU, ACCCA GUGCUUGAUUAUGA, CCAGUGAGAGUUCAUUU AU), siGENOME Non-Targeting siRNA Pool #1 Either HeLa cells or 293T cells were transfected ... data AM conceived and coordinated the study, analyzed the data and wrote the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have...
  • 15
  • 470
  • 0

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25