0

roles as a romantic partner and parent

báo cáo hóa học:

báo cáo hóa học:" Quality of Life as reported by children and parents: a comparison between students and child psychiatric outpatients" ppt

Hóa học - Dầu khí

... to several life domains [32] This concept is partly comprised of positive and negative affect as an emotional appraisal of health and life circumstances, as well as an emotional state that is determined ... parametric test Correlations were calculated by Pearson r and Spearman’s rho An alpha level of p < 0.05 indicated statistical significance Results Preliminary analysis The Spearman’s correlations ... students matched for sex and age, and that both child and parent proxy reports of QoL were obtained In addition all subjects resided in the same health care Jozefiak et al Health and Quality of...
  • 9
  • 494
  • 0
Talk it through childrens language skill as a mediator between intrusive parenting and childrens externalizing behavior problems

Talk it through childrens language skill as a mediator between intrusive parenting and childrens externalizing behavior problems

Cao đẳng - Đại học

... which children learn and practice their language skills On one hand, parents serve as natural template and the main source of information for children's language acquisition Parents' ability to provide ... gender was also negatively associated with CBCL attention problems The socio-economic status (SES) of participating families was negatively associated with parental intrusiveness, and positively associated ... showed that parent' s intrusive behavior was positively associated with children's aggressive subscale as well as destructive subscale from the CBCL The association between intrusive parenting and...
  • 132
  • 140
  • 0
Gender as a Health Determinant and Implications for Health Education pot

Gender as a Health Determinant and Implications for Health Education pot

Sức khỏe giới tính

... 147-159) Washington, DC: American Psychological Association Tennant, C (1999) Life stress, social support and coronary heart disease Australian and New Zealand Journal of Psychiatry, 33, 636-641 Davidson ... Psychological and modifiable Sociodemographic and somewhat modifiable Biological and not modifiable Figure A gender and health model that exemplifies how health education researchers and practitioners ... epidemiological findings and possible explanations Acta Psychiatrica Scandinavica, 108, 163-174 Luecken, L J., & Compas, B E (2002) Stress, coping, and immune function in breast cancer Annals of Behavioral...
  • 13
  • 504
  • 0
Báo cáo Y học: Mydj2 as a potent partner of hsc70 in mammalian cells doc

Báo cáo Y học: Mydj2 as a potent partner of hsc70 in mammalian cells doc

Báo cáo khoa học

... Characterization and comparison of large and small dj2 mRNAs (A) Schematic representation and sequence comparison of the monkey large dj2 cDNA and human small dj2 cDNA (B) Northern blot analysis ... order to bacterially express Mydj2 the corresponding cDNA was amplified by PCR using primer I (5¢-GCA GTAGAGGATCCTGAAAGAAA-3¢) and primer II (5¢-GTTATTCAGTCGACCATTAAGAGG-3¢) to generate the convenient ... and h of incubation with actinomycin D, cells (8 · 106) were washed with NaCl/Pi and total RNA was prepared Northern blot analysis and detection of both messages, large dj2 and small dj2 mRNAs,...
  • 8
  • 468
  • 0
English As a Second Language and English Literacy Development: A Resource Guide pdf

English As a Second Language and English Literacy Development: A Resource Guide pdf

Kỹ năng viết tiếng Anh

... modifications that will enable students from a variety of linguistic, ethnocultural, and educational backgrounds to participate as quickly and as fully as possible in all program areas and to achieve ... grade-appropriate – understand grade-appropriate text, with assistance text that may be unfamiliar and unsupported by visual – select main ideas in short pascontext clues, and that may sages from a variety ... English-speaking peers are available on a regular basis; • mistakes are accepted as a part of learning; • the purpose of various oral communication, reading, and writing tasks is clear to the learner;...
  • 126
  • 519
  • 0
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

Báo cáo khoa học

... RT-PCR using PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and the primers: PDZ-1-2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; ... 5¢-GTGGGGAAATATGCTCTTGAGGAGGT-3¢; primers 2, forward: 5¢-GTGACTTCAGAGACACTGCCA-3¢, and reverse: 5¢-CCCTTTCAAGTGTGATTTCTTC3¢; primers 3, forward: 5¢-ACCAGATGGTGAGAGCGAT-3¢, and reverse: 5¢-CTGTCTTTCATAGGTCCCAAT-3¢ ... mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT GTGA-3¢ and...
  • 11
  • 419
  • 0
Báo cáo khoa học: An antimicrobial peptide tachyplesin acts as a secondary secretagogue and amplifies lipopolysaccharide-induced hemocyte exocytosis potx

Báo cáo khoa học: An antimicrobial peptide tachyplesin acts as a secondary secretagogue and amplifies lipopolysaccharide-induced hemocyte exocytosis potx

Báo cáo khoa học

... phytopathogenic bacteria Erwinia carotovora infects Drosophila and activates an immune response Proc Natl Acad Sci USA 97, 3376–3381 Hirai Y, Kuwada M, Yasuhara T, Yoshida H & Nakajima T (1979) A ... identified as a stimulator that led to the release of histamine from rat mast cells [33] Mastoparan forms an amphiphilic a- helix, and its carboxyl terminus is amidated Mastoparan is a potent stimulator ... of Japan and by the Naito Foundation and Japan Foundation for Applied Enzymology (to S K.) 3869 An antimicrobial peptide as a secretagogue References Janeway CA Jr (1989) Approaching the asymptote?...
  • 9
  • 316
  • 0
báo cáo khoa học:

báo cáo khoa học: "Extramedullary hematopoiesis presenting as a compressive cord and cerebral lesion in a patient without a significant hematologic disorder: a case report" pptx

Báo cáo khoa học

... revealed a large extra-axial mass in her right frontal area, causing more than 10 mm midline shift, and a smaller mass in her left frontal area The lesion became enhanced after a contrast injection and ... appeared dark and vascular just below the dura mater and adhering to, and in some places invading, the pia matter Immediately after the operation, she became hemiparetic on her left side and a ... revealed a grade papilledema and mild paraparesis (muscle strength = 4/5) associated with generalized hyperreflexia and extensor plantar reflexes A whole axis contrast-enhanced magnetic study revealed...
  • 5
  • 245
  • 0
Báo cáo y học:

Báo cáo y học: "EXACKTE2: Exploiting the clinical consultation as a knowledge transfer and exchange environment: a study protocol" pptx

Báo cáo khoa học

... Research Chair in Health Knowledge Transfer and Uptake and leads Knowledge Translation Canada (KT Canada), a national research network in Canada FL, ML and MO are members of KT Canada References ... to as a measure of self-efficacy As stated by Makoul and Clayman, 'the rationale for incorporating a patient's efficacy expectation parallels the argument for discussing patient preferences and ... http://www.implementationscience.com/content/4/1/14 Table 1: Measurements and variables assessed Type of variable Variables assessed Scale or subscale Measures, Author, Year Number of items Timeframe Entry After consultation weeks after consultation...
  • 11
  • 369
  • 0
báo cáo khoa học:

báo cáo khoa học: " EXACKTE2: Exploiting the clinical consultation as a knowledge transfer and exchange environment: a study protocol" docx

Báo cáo khoa học

... Research Chair in Health Knowledge Transfer and Uptake and leads Knowledge Translation Canada (KT Canada), a national research network in Canada FL, ML and MO are members of KT Canada References ... to as a measure of self-efficacy As stated by Makoul and Clayman, 'the rationale for incorporating a patient's efficacy expectation parallels the argument for discussing patient preferences and ... http://www.implementationscience.com/content/4/1/14 Table 1: Measurements and variables assessed Type of variable Variables assessed Scale or subscale Measures, Author, Year Number of items Timeframe Entry After consultation weeks after consultation...
  • 11
  • 500
  • 0
ENVIRONMENTAL PLANNING IN RWANDA ENVIRONMENTAL IMPACT ASSESSMENT (EIA) AS a PLANNING TOOL AND ITS EFFECTIVENESS

ENVIRONMENTAL PLANNING IN RWANDA ENVIRONMENTAL IMPACT ASSESSMENT (EIA) AS a PLANNING TOOL AND ITS EFFECTIVENESS

Hóa học - Dầu khí

... the authority (REMA) Quality of the EIAs   on the basis that EIA is still new in Rwanda , the latter has been encouraging as many individuals as possible to participate in carrying out EIAs, ... Rwanda   Under the present legislation, several government departments, private companies, and parastatal organisations undertake EIAs; that some forms of environmental assessments have occasionally ... Presentation Outline       Definition of EIA; Historical Background and Context of EIA in Rwanda; Policy and Legal Framework on EIA; International Context of EIA; EIA Practice in Rwanda: EIA...
  • 34
  • 332
  • 0
The roles of rac1 and syncollin in regulated exocytosis  insulin secreting INS 1 cells as a model

The roles of rac1 and syncollin in regulated exocytosis insulin secreting INS 1 cells as a model

Cao đẳng - Đại học

... including mast cells, platelets and neutrophils (Brown et al., 1998; Chatah and Abrams, 2001; Rosales and Ernst, 2000), and adrenal chromaffin cells (Gandia et al., 1997; Vitale et al., 2000), are also ... et al., 1990) Different mammalian Rho GTPases are at least 40% identical to each other at the amino-acid level, whereas they are approximately 25% identical to Ras To date, only Rho, Rac, and ... membrane ruffles It appears to regulate cadherin-catenin interactions during cell adhesion and mediate actin reorganization (McCallum et al., 1998; Natale and Watson, 2002) Rac can associate with...
  • 140
  • 249
  • 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Nông nghiệp

... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... flavor and in overall flavor, and stronger in after-taste than the sample with a regular aroma concentration The heightened aroma concentration caused a slight off-flavor described as ‘artificial’ ... a small food reward after the last evaluation session Samples The sample material was a fermented oat bran product (Yosaw, Bioferme, Finland), which is a cereal-based snack food similar to flavored...
  • 10
  • 599
  • 1
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier

Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier

Tài liệu khác

... BA R = B B A where AUC is the area under the curve Statistical analysis All data are presented as a mean value with its standard deviation indicated (mean ± SD) Statistical analysis was conducted ... (Mw = 200,000) was purchased from Hayashibara (Tokyo, Japan) Epirubicin·HCl (EPI·HCl) was purchased from Hisun Pharmaceutical Co (Zhejiang, China) Poly (vinyl alcohol) (PVA) with an average molecular weight ... main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically active drug that reaches the...
  • 7
  • 391
  • 0
Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats

Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats

Môi trường

... E2, and E5) were comparable to that in E3 as well as the natural tidal flat (C3) Also, the distribution of gastropods, polychaetes and bivalves was consistent in the artificial and natural tidal ... observed variation in the macrobenthos population in the artificial tidal flats and the natural tidal flat The abundance of macrobenthos in the artificial tidal flats increased after May 28 and finally ... chloride (PAC) as well as waste steel slag (WSS) (E5) A natural tidal flat (C3) at the same tidal level was chosen as a reference for monitoring benthic communities as well as physicochemical characteristics...
  • 13
  • 586
  • 0
CFD and comparisons for a pump as turbine: Mesh reliability and performance concerns

CFD and comparisons for a pump as turbine: Mesh reliability and performance concerns

Môi trường

... Ramos et al are available for the first case and guide vane closure of a turbine, and they were obtained in lab conditions and compared with a reliable one-dimensional calculation Ramos et al ... post-doc, PhDs and MSc students Email address: armando.carravetta@unina.it Web address: http://www.docenti.unina.it/armando.carravetta Helena M Ramos has Ph.D degree and is Professor at Instituto ... are bigger, the mesh is coarser and the geometrical accuracy is smaller Since the narrowest passages are good modelled, the internal leakages are lower and the computed efficiency increases as...
  • 10
  • 419
  • 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

Môi trường

... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release ... precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital and operating costs and minimizes degradation reactions The ... endo-glucanase, exo-glucanase and β-glucosidase Endo -and exo-glucanases are commonly referred to as “cellulases” Fungal strains of Trichoderma reesei are used to produce most commercial cellulase...
  • 20
  • 437
  • 0
A contrastive analysis of encouraging as a speech act in english and vietnamese

A contrastive analysis of encouraging as a speech act in english and vietnamese

Khoa học xã hội

... notions about pragmatics such as Contexts and Meaning, Conversational theory, 10 Politeness, Cooperative principle and Conversational implicature etc with analysis and Vietnamese data Speech act ... English as an international language in this century, there are a great number of the Vietnamese people who learn and speak English In fact, in learning English as a foreign language, the Vietnamese ... questionnaires These questionnaires are translated into Vietnamese for the Vietnamese My survey on a contrastive analysis of encouraging as a speech act in English and Vietnamese is an attempt...
  • 13
  • 1,583
  • 8
Tài liệu Toilet design for rural areas and separated urine collection as a fertilizer source pptx

Tài liệu Toilet design for rural areas and separated urine collection as a fertilizer source pptx

Điện - Điện tử

... living standards, education and health conditions, and others As a result, the farmers are limited to receive enough clean water supply and sanitation facilities as a social beneficiary Furthermore, ... urine as mineral fertilizer Poster Bonn University, Germany Vietnam National program on Clean water and Rural sanitation (2002) Objectives of national strategies on clean water and rural sanitation ... some data of the chemical feces and urine composition of the human and animal in Vietnam (Table 3) as well as average rate of excretion (Table 4) Table 3: Chemical composition of excreta and urine...
  • 7
  • 476
  • 1
Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

Cao đẳng - Đại học

... monogenism and polygenism Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth Eurafrica, Austafrica, Asia, America, ... languages Universal alphabets Logical relations of the parts of speech The vocabulary and the grammar of languages Distinctions between languages and dialects Mixed languages and jargons Relations ... utensils, weapons, and agricultural, etc., implements Architecture and building Clothing and fashions Means of transportation by land and water Agriculture Domestication of plants and animals Weights,...
  • 28
  • 665
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25